Dataset for CDS BMF of organism Podarcis muralis

[Download (right click)] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A670JUU6_BMF-04      atgaattcctatatagaagtcacattaacctcagtgggaatggacttatt
A0A670JUU6_BMF-01      atgaattcctatatagaagtcacattaacctcagtgggaatggacttatt
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-02      --------------------------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------
                                                                         

A0A670JUU6_BMF-04      tccaggtgaaatggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-01      tccaggtgaaatggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-05      ----------atggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-02      ----------atggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-03      ----------atggattcccctgactacctggaggaggatttctccaatc
                                 ****************************************

A0A670JUU6_BMF-04      tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-01      tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-05      tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-02      tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-03      tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
                       **************************************************

A0A670JUU6_BMF-04      agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-01      agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-05      agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-02      agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-03      agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
                       **************************************************

A0A670JUU6_BMF-04      ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-01      ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-05      ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-02      ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-03      ttacaactgccttctggggagattccagctcttcccacttacacactgtt
                       **************************************************

A0A670JUU6_BMF-04      gcggcccaggcaccaggcatgccaagcagcaagataaggcaactcaaacc
A0A670JUU6_BMF-01      gcggcccaggcaccaggcatgccaagcagcaagataaggcaactcaaacc
A0A670JUU6_BMF-05      gcggcccaggcaccaggcatgccaagcagcaagataaggcaactcaaacc
A0A670JUU6_BMF-02      gcggcccaggcaccaggcatgccaagcagcaagataaggcaactcaaacc
A0A670JUU6_BMF-03      gcggcccaggcaccaggcatgccaagcagcaagataaggcaactcaaacc
                       **************************************************

A0A670JUU6_BMF-04      ctcaacccatcctcttctagccaggatgtcatgttaccttgtggagtcac
A0A670JUU6_BMF-01      ctcaacccatcctcttctagccaggatgtcatgttaccttgtggagtcac
A0A670JUU6_BMF-05      ctcaacccatcctcttctagccaggatgtcatgttaccttgtggagtcac
A0A670JUU6_BMF-02      ctcaacccatcctcttctagccaggatgtcatgttaccttgtggagtcac
A0A670JUU6_BMF-03      ctcaacccatcctcttctagccaggatgtcatgttaccttgtggagtcac
                       **************************************************

A0A670JUU6_BMF-04      tgaagagccccagagactcttctatgggaacgccgggttccgtttacatg
A0A670JUU6_BMF-01      tgaagagccccagagactcttctatgggaacgccgggttccgtttacatg
A0A670JUU6_BMF-05      tgaagagccccagagactcttctatgggaacgccgggttccgtttacatg
A0A670JUU6_BMF-02      tgaagagccccagagactcttctatgggaacgccgggttccgtttacatg
A0A670JUU6_BMF-03      tgaagagccccagagactcttctatgggaacgccgggttccgtttacatg
                       **************************************************

A0A670JUU6_BMF-04      tcaaccccattggtttctcattgagtccacacctccgggaggaacctcgg
A0A670JUU6_BMF-01      tcaaccccattggtttctcattgagtccacacctccgggaggaacctcgg
A0A670JUU6_BMF-05      tcaaccccattggtttctcattgagtccacacctccgggaggaacctcgg
A0A670JUU6_BMF-02      tcaaccccattggtttctcattgagtccacacctccgggaggaacctcgg
A0A670JUU6_BMF-03      tcaaccccattggtttctcattgagtccacacctccgggaggaacctcgg
                       **************************************************

A0A670JUU6_BMF-04      gaaagcccacaggaactgcgaactgaagttcagattgcacggaagttaca
A0A670JUU6_BMF-01      gaaagcccacaggaactgcgaactgaagttcagattgcacggaagttaca
A0A670JUU6_BMF-05      gaaagcccacaggaactgcgaactgaagttcagattgcacggaagttaca
A0A670JUU6_BMF-02      gaaagcccacaggaactgcgaactgaagttcagattgcacggaagttaca
A0A670JUU6_BMF-03      gaaagcccacaggaactgcgaactgaagttcagattgcacggaagttaca
                       **************************************************

A0A670JUU6_BMF-04      gtgcattgcggaccagtttcacaggctgcacctacagaggatttgcatga
A0A670JUU6_BMF-01      gtgcattgcggaccagtttcacaggctgcacctacagaggcaccagcaga
A0A670JUU6_BMF-05      gtgcattgcggaccagtttcacaggctgcacctacagaggcaccagcaga
A0A670JUU6_BMF-02      gtgcattgcggaccagtttcacaggctgcacctacagaggatttgcatga
A0A670JUU6_BMF-03      gtgcattgcggaccagtttcacaggctgcacctacagaggctttatccat
                       ****************************************          

A0A670JUU6_BMF-04      aggatctgcattttccactgctgtctgtgaagattaaggtccgttttcct
A0A670JUU6_BMF-01      acc-----------------------------------------------
A0A670JUU6_BMF-05      acc-----------------------------------------------
A0A670JUU6_BMF-02      aggatctgcattttccactgctgtctgtgaagattaaggtccgttttcct
A0A670JUU6_BMF-03      ggc-----------------------------------------------
                                                                         

A0A670JUU6_BMF-04      ccccgtatcctcagcacttgttcagctgttggtaagaaaaaagggatggt
A0A670JUU6_BMF-01      -----------------------------------gaaaccaggtctg--
A0A670JUU6_BMF-05      -----------------------------------gaaaccaggtctg--
A0A670JUU6_BMF-02      ccccgtatcctcagcacttgttcagctgttggtaagaaaaaagggatggt
A0A670JUU6_BMF-03      -------------------------------------cactcagcctg--
                                                             *    *  **  

A0A670JUU6_BMF-04      gaggtttgaaagagctctggatcctcaaagagagggtacatacactcagg
A0A670JUU6_BMF-01      --------------------------------------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-02      gaggtttgaaagagctctggatcctcaaagagagggtacatacactcagc
A0A670JUU6_BMF-03      --------------------------------------------------
                                                                         

A0A670JUU6_BMF-04      caaaccccacta----cgggaagtgaaggaactctgtggagaaa--gaga
A0A670JUU6_BMF-01      -----------------------gtggcagatcctccttttcctccataa
A0A670JUU6_BMF-05      -----------------------gtggcagatcctccttttcctccataa
A0A670JUU6_BMF-02      tttatccatggccactcagcctgaaacgggactctgctgggcggccgaaa
A0A670JUU6_BMF-03      -----------------------aaacgggactctgctgggcggccgaaa
                                                     *  **              *

A0A670JUU6_BMF-04      atgttgcaaacaacagatggaggagttttggagcaggaggtgcaccctag
A0A670JUU6_BMF-01      cgtggc-gttgaa-----------------------------catggagg
A0A670JUU6_BMF-05      cgtggc-gttgaa-----------------------------catggagg
A0A670JUU6_BMF-02      aggctccagtgct---------------------------tgtctccagc
A0A670JUU6_BMF-03      aggctccagtgct---------------------------tgtctccagc
                                                                         

A0A670JUU6_BMF-04      gaagcccacggaaca-------------------cgtaataccaaaataa
A0A670JUU6_BMF-01      ccaacagacaccacgcgggtcggagctttatccatggccactcagcctga
A0A670JUU6_BMF-05      ccaacagacaccacgc---------------------gggtcggaggtga
A0A670JUU6_BMF-02      tcagaggacactgtg-------------------gtgcatctctgaatga
A0A670JUU6_BMF-03      tcagaggacactgtg-------------------gtgcatctctgaatga
                         *    **                                      * *

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice