Dataset for CDS BMF of organism Podarcis muralis

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A670JUU6_BMF-01      atgaattcctatatagaagtcacattaacctcagtgggaatggacttatt
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      atgaattcctatatagaagtcacattaacctcagtgggaatggacttatt
A0A670JUU6_BMF-02      --------------------------------------------------
A0A670JUU6_BMF-03      --------------------------------------------------

A0A670JUU6_BMF-01      tccaggtgaaatggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-05      ----------atggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-04      tccaggtgaaatggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-02      ----------atggattcccctgactacctggaggaggatttctccaatc
A0A670JUU6_BMF-03      ----------atggattcccctgactacctggaggaggatttctccaatc

A0A670JUU6_BMF-01      tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-05      tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-04      tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-02      tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc
A0A670JUU6_BMF-03      tagatgggctggaggatgatgtcttccactctgaagactgtggacttgcc

A0A670JUU6_BMF-01      agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-05      agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-04      agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-02      agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc
A0A670JUU6_BMF-03      agtcaacccaatgagatgacatttcctggcattttcacacagagtaaatc

A0A670JUU6_BMF-01      ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-05      ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-04      ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-02      ttacaactgccttctggggagattccagctcttcccacttacacactgtt
A0A670JUU6_BMF-03      ttacaactgccttctggggagattccagctcttcccacttacacactgtt

A0A670JUU6_BMF-01      gcggcccaggcaccaggcatgccaagcagcaagataaggcaactcaaacc
A0A670JUU6_BMF-05      gcggcccaggcaccaggcatgccaagcagcaagataaggcaactcaaacc
A0A670JUU6_BMF-04      gcggcccaggcaccaggcatgccaagcagcaagataaggcaactcaaacc
A0A670JUU6_BMF-02      gcggcccaggcaccaggcatgccaagcagcaagataaggcaactcaaacc
A0A670JUU6_BMF-03      gcggcccaggcaccaggcatgccaagcagcaagataaggcaactcaaacc

A0A670JUU6_BMF-01      ctcaacccatcctcttctagccaggatgtcatgttaccttgtggagtcac
A0A670JUU6_BMF-05      ctcaacccatcctcttctagccaggatgtcatgttaccttgtggagtcac
A0A670JUU6_BMF-04      ctcaacccatcctcttctagccaggatgtcatgttaccttgtggagtcac
A0A670JUU6_BMF-02      ctcaacccatcctcttctagccaggatgtcatgttaccttgtggagtcac
A0A670JUU6_BMF-03      ctcaacccatcctcttctagccaggatgtcatgttaccttgtggagtcac

A0A670JUU6_BMF-01      tgaagagccccagagactcttctatgggaacgccgggttccgtttacatg
A0A670JUU6_BMF-05      tgaagagccccagagactcttctatgggaacgccgggttccgtttacatg
A0A670JUU6_BMF-04      tgaagagccccagagactcttctatgggaacgccgggttccgtttacatg
A0A670JUU6_BMF-02      tgaagagccccagagactcttctatgggaacgccgggttccgtttacatg
A0A670JUU6_BMF-03      tgaagagccccagagactcttctatgggaacgccgggttccgtttacatg

A0A670JUU6_BMF-01      tcaaccccattggtttctcattgagtccacacctccgggaggaacctcgg
A0A670JUU6_BMF-05      tcaaccccattggtttctcattgagtccacacctccgggaggaacctcgg
A0A670JUU6_BMF-04      tcaaccccattggtttctcattgagtccacacctccgggaggaacctcgg
A0A670JUU6_BMF-02      tcaaccccattggtttctcattgagtccacacctccgggaggaacctcgg
A0A670JUU6_BMF-03      tcaaccccattggtttctcattgagtccacacctccgggaggaacctcgg

A0A670JUU6_BMF-01      gaaagcccacaggaactgcgaactgaagttcagattgcacggaagttaca
A0A670JUU6_BMF-05      gaaagcccacaggaactgcgaactgaagttcagattgcacggaagttaca
A0A670JUU6_BMF-04      gaaagcccacaggaactgcgaactgaagttcagattgcacggaagttaca
A0A670JUU6_BMF-02      gaaagcccacaggaactgcgaactgaagttcagattgcacggaagttaca
A0A670JUU6_BMF-03      gaaagcccacaggaactgcgaactgaagttcagattgcacggaagttaca

A0A670JUU6_BMF-01      gtgcattgcggaccagtttcacaggctgcacctacagag-----------
A0A670JUU6_BMF-05      gtgcattgcggaccagtttcacaggctgcacctacagag-----------
A0A670JUU6_BMF-04      gtgcattgcggaccagtttcacaggctgcacctacagaggatttgcatga
A0A670JUU6_BMF-02      gtgcattgcggaccagtttcacaggctgcacctacagaggatttgcatga
A0A670JUU6_BMF-03      gtgcattgcggaccagtttcacaggctgcacctacagag-----------

A0A670JUU6_BMF-01      --------------------------------------------------
A0A670JUU6_BMF-05      --------------------------------------------------
A0A670JUU6_BMF-04      aggatctgcattttccactgctgtctgtgaagattaaggtccgttttcct
A0A670JUU6_BMF-02      aggatctgcattttccactgctgtctgtgaagattaaggtccgttttcct
A0A670JUU6_BMF-03      --------------------------------------------------

A0A670JUU6_BMF-01      ----gcaccagcagaacc-----------------gaaaccaggtctggt
A0A670JUU6_BMF-05      ----gcaccagcagaacc-----------------gaaaccaggtctggt
A0A670JUU6_BMF-04      ccccgtatcctcagcacttgttcagctgttggtaagaaaaaagggatggt
A0A670JUU6_BMF-02      ccccgtatcctcagcacttgttcagctgttggtaagaaaaaagggatggt
A0A670JUU6_BMF-03      --------------------------------------------------

A0A670JUU6_BMF-01      gg---------------cagatcct-------------------------
A0A670JUU6_BMF-05      gg---------------cagatcct-------------------------
A0A670JUU6_BMF-04      gaggtttgaaagagctctggatcctcaaagagagggtacatacactcagg
A0A670JUU6_BMF-02      gaggtttgaaagagctctggatcctcaaagagagggtacatacactcagc
A0A670JUU6_BMF-03      ------------------------------------------------gc

A0A670JUU6_BMF-01      -----ccttttcctccataacgtggcgttgaac---atggag--------
A0A670JUU6_BMF-05      -----ccttttcctccataacgtggcgttgaac---atggag--------
A0A670JUU6_BMF-04      caaacc-----ccactacgggaagtgaaggaactctgtggagaaagagaa
A0A670JUU6_BMF-02      tttatccatggccact-cagcctgaaacgggactctgctggg--------
A0A670JUU6_BMF-03      tttatccatggccact-cagcctgaaacgggactctgctggg--------
                            *     ** *        *     * **      * *        

A0A670JUU6_BMF-01      -------gccaacagaca---------------------------ccacg
A0A670JUU6_BMF-05      -------gccaacagaca---------------------------ccacg
A0A670JUU6_BMF-04      tgttgcaaacaacagatggaggagttttggagcaggaggtgcaccctagg
A0A670JUU6_BMF-02      ------------cggccgaaaaggctccagtgc-----ttgtctcc----
A0A670JUU6_BMF-03      ------------cggccgaaaaggctccagtgc-----ttgtctcc----
                                   * *                              *    

A0A670JUU6_BMF-01      cgggtcggagctttatccatggccactcagcctga
A0A670JUU6_BMF-05      cgggtcggag---------------------gtga
A0A670JUU6_BMF-04      aagcccacggaacac-gtaatac----caaaataa
A0A670JUU6_BMF-02      -agctcagaggacactgtggtgcatctctgaatga
A0A670JUU6_BMF-03      -agctcagaggacactgtggtgcatctctgaatga
                         *  *   *                      * *

© 1998-2021Legal notice