Dataset for CDS classical BH3-containing proteins of organism Phocoena sinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9CBP3_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8C9CBP3_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8C9CBP3_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8C9CBP3_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A8C9CVE1_BBC3-01      atggc----------ccg------------------agcacgccaggagg
A0A8C9E480_HRK-01       atg-----------------------------------------------
A0A8C9BKQ1_BMF-01       atgga----------gcc-accccagtgtgtg----gag-gagctggagg
A0A8C9DZ46_BAD-01       atgtt----------ccagatcccagagtttgagcagagtgagcaggaag
                        ***                                               

A0A8C9CBP3_BCL2L11      acaattgcagcctgccg---------------aaaggcctcctcagctca
A0A8C9CBP3_BCL2L11      acaattgcagcctgccg---------------aaaggcctcctcagctca
A0A8C9CBP3_BCL2L11      acaattgcagcctgccg---------------aaaggcctcctcagctca
A0A8C9CBP3_BCL2L11      acaattgcagcctgccg---------------aaaggcctcctcagctca
A0A8C9CVE1_BBC3-01      gcagctcccccgagccc------------gtagagggcctggcccgcgac
A0A8C9E480_HRK-01       --------------------------------------------------
A0A8C9BKQ1_BMF-01       atgatgtgttccagcca-gaggatggggagccggggacccagcct----g
A0A8C9DZ46_BAD-01       a-------ctccagccctgcagataggg-gcctgggccccagccccacag
                                                                          

A0A8C9CBP3_BCL2L11      ggcctggggcccccatctctctacagacagagcggcaaggtaatcccgaa
A0A8C9CBP3_BCL2L11      ggcctggggcccccatctctctacagacagagcggcaaggtaatcccgaa
A0A8C9CBP3_BCL2L11      ggcctggggcccccatctctctacagacagagcggca-------------
A0A8C9CBP3_BCL2L11      ggcctggggcccccatctctctacagacagagcggcaaggtaatcccgaa
A0A8C9CVE1_BBC3-01      ggcccgcgtcccttc------------cccctcagccgcctg--------
A0A8C9E480_HRK-01       tgcccgtgccccctg------------caccgcggccg------------
A0A8C9BKQ1_BMF-01       ggagcttgctctctgctgacctgtttgcccag-agccagctg--------
A0A8C9DZ46_BAD-01       gggacaggcccccaggt----------cccagcaagcaccgg--------
                         *     *  *                *                      

A0A8C9CBP3_BCL2L11      ggagaaggggaccgctgcccccaaggcagcccacagggcccact------
A0A8C9CBP3_BCL2L11      ggagaaggggaccgctgcccccaaggcagcccacagggcccact------
A0A8C9CBP3_BCL2L11      --------------------------------------------------
A0A8C9CBP3_BCL2L11      ggagaaggggaccgctgcccccaaggcagcccacagggcccact------
A0A8C9CVE1_BBC3-01      ----------------gtgccctcggccgtatcctgcggcctctgcgaac
A0A8C9E480_HRK-01       --------------------------------------------------
A0A8C9BKQ1_BMF-01       ------------gactgccccctcagccgtct----g-------------
A0A8C9DZ46_BAD-01       ------------caaagggtcccaggcctcctggggg-------------
                                                                          

A0A8C9CBP3_BCL2L11      -ggccccaccggccagtcccggccctttcgctaccagatccccgcttttc
A0A8C9CBP3_BCL2L11      -ggccccaccggccagtcccggccctttcgctaccagatccccgcttttc
A0A8C9CBP3_BCL2L11      --------------------------------------------------
A0A8C9CBP3_BCL2L11      -ggccccaccggccagtcccggccctttcgctaccagatccccgcttttc
A0A8C9CVE1_BBC3-01      ccggcctgcctgccgcccccgccgcccccgccctgctgccc--gccgcct
A0A8C9E480_HRK-01       -cggcccgccggcggtgtgcg----------cctgcagcgcgggccgcct
A0A8C9BKQ1_BMF-01       -cagctcttccctctcacgcactgctgtggccctgggcttcgacccacca
A0A8C9DZ46_BAD-01       -aagctggtcaccagca----------------ggggcagccagccagca
                                                                          

A0A8C9CBP3_BCL2L11      atcttcgtgagaagatcttccctgctgtctcgatcctccagtgggtattt
A0A8C9CBP3_BCL2L11      atcttcgtgagaagatcttccctgctgtctcgatcctccagtgggtattt
A0A8C9CBP3_BCL2L11      --------------------------------------------------
A0A8C9CBP3_BCL2L11      atcttcgtgagaagatcttccctgctgtctcgatcctccagtgggtattt
A0A8C9CVE1_BBC3-01      acctctgc-------gccc--ccaccgccccg-cccgccg----------
A0A8C9E480_HRK-01       gggtctgc-------gctcgtccgccgcgcag-ctcacgg----------
A0A8C9BKQ1_BMF-01       g------ccaggaagaca---aggctacccagactctcag----------
A0A8C9DZ46_BAD-01       gcagccaccatggaggcactggggctgtggagacccggag----------
                                                                          

A0A8C9CBP3_BCL2L11      ctcttttgacacagac---------------------------------a
A0A8C9CBP3_BCL2L11      ctcttttgacacagac---------------------------------a
A0A8C9CBP3_BCL2L11      ------------agac---------------------------------a
A0A8C9CBP3_BCL2L11      ctcttttgacacagac---------------------------------a
A0A8C9CVE1_BBC3-01      -----tcaccgccgccctgggggccccccgctggcctgggggtcctcgca
A0A8C9E480_HRK-01       -----ccgcc-cggctcaaggcgctcggcgacg----------------a
A0A8C9BKQ1_BMF-01       -----tc----cagcct------ccccaagcca----------------g
A0A8C9DZ46_BAD-01       -----tcgccacagctc------ctactccgcg----------------g
                                     *                                    

A0A8C9CBP3_BCL2L11      ggagcccggcacccatgagttgtgaca-----------------------
A0A8C9CBP3_BCL2L11      ggagcccggcacccatgagttgtgaca-----------------------
A0A8C9CBP3_BCL2L11      ggagcccggcacccatgagttgtgaca-----------------------
A0A8C9CBP3_BCL2L11      ggagcccggcacccatgagttgtgaca-----------------------
A0A8C9CVE1_BBC3-01      gccggccccgtggcccgcgcctcgacggtccacagccctcactctcgccc
A0A8C9E480_HRK-01       gctgcaccagcgcaccatgtggcggcg-----------------ccgcgc
A0A8C9BKQ1_BMF-01       ggtgtcatgctgccttgtggggtgact-----------------------
A0A8C9DZ46_BAD-01       gg----acggaggatgaagaagggacg-----------------------
                        *                 *    * *                        

A0A8C9CBP3_BCL2L11      aatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctc
A0A8C9CBP3_BCL2L11      aatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctc
A0A8C9CBP3_BCL2L11      aatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctc
A0A8C9CBP3_BCL2L11      aatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctc
A0A8C9CVE1_BBC3-01      gcggagcagcacc---------------tggaatcgccagtgcccagcgc
A0A8C9E480_HRK-01       gcggag-----cc---------------ggagggcgccggcgcccagcgc
A0A8C9BKQ1_BMF-01       gagga-----accccagcgactcttttatggcaatgccggctaccggctc
A0A8C9DZ46_BAD-01       gaggaggaggagcccagc--cccttccggggc--cgctcgcgctcggcgc
                            *       *                                  * *

A0A8C9CBP3_BCL2L11      agtgcgatggcttccatgaggcagtctcaggctgt---------------
A0A8C9CBP3_BCL2L11      agtgcgat------------------------------------------
A0A8C9CBP3_BCL2L11      agtgcgatggcttccatgaggcagtctcaggctgt---------------
A0A8C9CBP3_BCL2L11      agtgcgatggcttccatgaggcagtctcaggctgt---------------
A0A8C9CVE1_BBC3-01      cccgggggccctggcgggcggccccacccaagcgg---------------
A0A8C9E480_HRK-01       gct------------------ccccacctac-tgg---------------
A0A8C9BKQ1_BMF-01       c--------------------ccctccctgc-cggtttccctgcaggctt
A0A8C9DZ46_BAD-01       c--------------------ccccaacctc-tgg---------------
                                                                          

A0A8C9CBP3_BCL2L11      ------------------acctgcagatatgcg---------tccggaga
A0A8C9CBP3_BCL2L11      --------------------------------------------------
A0A8C9CBP3_BCL2L11      ------------------acctgcagatatgcg---------tccggaga
A0A8C9CBP3_BCL2L11      ------------------acctgcagatatgcg---------tccggaga
A0A8C9CVE1_BBC3-01      ------------------ccccgggagtccggggggaggaggagcagtgg
A0A8C9E480_HRK-01       ------------------ccctgg--------------------------
A0A8C9BKQ1_BMF-01       gccccttggtgagcagcccgctgaagggcagtggcaacatcgagcagagg
A0A8C9DZ46_BAD-01       -------------------gctgcacggcgata-----------------
                                                                          

A0A8C9CBP3_BCL2L11      tatggattgcgcaag----agttgcggcgtattggagacgaatttaatgc
A0A8C9CBP3_BCL2L11      --------------------------------------------------
A0A8C9CBP3_BCL2L11      tatggattgcgcaag----agttgcggcgtattggagacgaatttaatgc
A0A8C9CBP3_BCL2L11      tatggattgcgcaag----agttgcggcgtattggagacgaatttaatgc
A0A8C9CVE1_BBC3-01      gcccgagagatcggggcccagctgcggcggatggcggacgatctcaacgc
A0A8C9E480_HRK-01       -----------ctgtgcgcggccgc-gcaggtggcg------------gc
A0A8C9BKQ1_BMF-01       tacagattgcccgaa----aacttcagcgcattgcagaccagttccatcg
A0A8C9DZ46_BAD-01       -------tggccgag----agctccggaggatgagcgacgagttcca-cg
                                                                          

A0A8C9CBP3_BCL2L11      atattac-ccaaggagg-----ttagagcaatag----------------
A0A8C9CBP3_BCL2L11      ---------------gggtctttctgaataa-------------------
A0A8C9CBP3_BCL2L11      atattac-ccaaggagggtctttctgaataatcaccaagcagccgaaggt
A0A8C9CBP3_BCL2L11      atattac-ccaaggagggtctttctgaataatcaccaagcagccgaaggt
A0A8C9CVE1_BBC3-01      gctgtac-gaacggcggagacaagaggagcagcagcgacaccgcccctcc
A0A8C9E480_HRK-01       gct---------ggcgg---------------------------------
A0A8C9BKQ1_BMF-01       gcttcat-atgcagcaacaccagcagaaccgaaatcgcgtgtg-------
A0A8C9DZ46_BAD-01       gctccttcaagggacttcctcgcccgaacag----cgcgggcacag----
                                                                          

A0A8C9CBP3_BCL2L11      --------------------------------------------------
A0A8C9CBP3_BCL2L11      --------------------------------------------------
A0A8C9CBP3_BCL2L11      cacccgcaaatggttatcttacggctcttacgccacatcatccgtctggt
A0A8C9CBP3_BCL2L11      cacccgcaaatggttatcttacggctcttacgccacatcatccgtctggt
A0A8C9CVE1_BBC3-01      ccctggagggtcctgtacaatctcatcatgggactcctgc-ccttaccca
A0A8C9E480_HRK-01       -cctgg------------------------------ctgc-tc-------
A0A8C9BKQ1_BMF-01       -----------gtggcagatcctcctctttctgcacaacc-tcgctttga
A0A8C9DZ46_BAD-01       -cgacgcagatgcgacaaagccccagctggacgcgcttccttcagtcctg
                                                                          

A0A8C9CBP3_BCL2L11      ----------------------------------------------
A0A8C9CBP3_BCL2L11      ----------------------------------------------
A0A8C9CBP3_BCL2L11      gtggagga------------------------------tgcagtga
A0A8C9CBP3_BCL2L11      gtggagga------------------------------tgcagtga
A0A8C9CVE1_BBC3-01      ggggccgcggagcc---cccgagatggagc--------ccaattag
A0A8C9E480_HRK-01       --ggc----------------aggcggaac--------ttg--tag
A0A8C9BKQ1_BMF-01       atggagatgagaacaggaatggggcgggtc--------ccaggtga
A0A8C9DZ46_BAD-01       gtggaaccggaacttggcgagaggaggccccgccccctcccagtga
                                                                      

© 1998-2022Legal notice