Dataset for CDS classical BH3-containing proteins of organism Phasianus colchicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A669PL85_BMF-01       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A669PL85_BMF-02       atggatcgccccagctacctggaagaggactattctagcctggatgggct
A0A669QIC6_PMAIP1-      at-g-----cctggc--------------------------ag---gacg
A0A669QMB4_BCL2L11      atgg-----ccaagc--------------------------agccccccg
                        ** *     **  **                           *     * 

A0A669PL85_BMF-01       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A669PL85_BMF-02       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A669QIC6_PMAIP1-      attcgcaaacccgcgccgccc------------------------gccgc
A0A669QMB4_BCL2L11      aggcgaaggcgccccgcgacc------------------------gccgg
                           **    *      *   *                        ***  

A0A669PL85_BMF-01       gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A669PL85_BMF-02       gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A669QIC6_PMAIP1-      gcctgcaggtagggaaaggcgaagggaggcgggtct--caatttttttac
A0A669QMB4_BCL2L11      gccgggcggctgccgccgg-gagaggggccgggcccggccgtcccgctgc
                        *   *  *   *     **          * *  *      *     * *

A0A669PL85_BMF-01       cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A669PL85_BMF-02       cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A669QIC6_PMAIP1-      g----gggg-----------------------ttgatactgga-------
A0A669QMB4_BCL2L11      ggcccgggg-----------------------cccctgccgcgctgcccg
                             ****                           * * *         

A0A669PL85_BMF-01       tgtcaggcaaccagagcagcaggacaaggcaactcaaacactcagcccgt
A0A669PL85_BMF-02       tgtcaggcaaccagagcagcaggacaaggcaactcaaacactcagcccgt
A0A669QIC6_PMAIP1-      -----------------------aaaaagcaag-------cttttccctt
A0A669QMB4_BCL2L11      ----gcgccgcccggcccgcctcgcccggcagc-------cccggcccgt
                                                    ***         *    *** *

A0A669PL85_BMF-01       cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A669PL85_BMF-02       cctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccc
A0A669QIC6_PMAIP1-      t-----------------ttcttttccttttt------------------
A0A669QMB4_BCL2L11      tcgccatccg-ctcgccgctcttcttcttcgtgcggaggtccccgctgct
                                           * *  * * *  *                  

A0A669PL85_BMF-01       cggagactcttctatgggaatgctggttaccgcttacatgtcc-------
A0A669PL85_BMF-02       cggagactcttctatgggaatgctggttaccgcttacatgtcc-------
A0A669QIC6_PMAIP1-      ------cttctc---------------taccgtcttctttccct------
A0A669QMB4_BCL2L11      gccgcgctcctc---------------cagcgggtacttctccttcgagg
                              **  **                * **  * * *  **       

A0A669PL85_BMF-01       ----------cccca-----gttggctttg---------cattggatcca
A0A669PL85_BMF-02       ----------cccca-----gttggctttg---------cattggatcca
A0A669QIC6_PMAIP1-      ----------ccccgatatcgctgtctg-gaaaagacctcgttagaatta
A0A669QMB4_BCL2L11      ccgagcgcagccccgcgcccatgagctgcgataaggccacg-------ca
                                  ****           **  *         *         *

A0A669PL85_BMF-01       aatctccaagaagagcctcaggaaggtc-----------agcgggaggcg
A0A669PL85_BMF-02       aatctccaagaagagcctcaggaaggtc-----------agcgggaggcg
A0A669QIC6_PMAIP1-      aatcccc----atcgccctgcgcgtgttttgcag-----agcgggacgcg
A0A669QMB4_BCL2L11      gaccccc----agcccgccgtgccaggccgtcagccactacctgagcgcc
                         * * **    *   *     *   *             * * *   ** 

A0A669PL85_BMF-01       cgtactg--aggtg------------------------------------
A0A669PL85_BMF-02       cgtactg--aggtg------------------------------------
A0A669QIC6_PMAIP1-      gtggct---gagtg------------------------------------
A0A669QMB4_BCL2L11      atggcttccaggtggcgatctcactcacttgcagaagaaatacaaccaga
                            **     ***                                    

A0A669PL85_BMF-01       ----cagattgcacggaagttgcagtgcattgcagaccagttccaccggc
A0A669PL85_BMF-02       ----cagattgcacggaagttgcagtgcattgcagaccagttccaccggc
A0A669QIC6_PMAIP1-      ---------cgcgctggagctgcgcaggatcggcgacaagg----cgga-
A0A669QMB4_BCL2L11      aatatggattgcacaggagctgcggcgcatcggggatgaat----tcaat
                                  ** * * ** ***   * ** *  **  *           

A0A669PL85_BMF-01       tccacatacagc---gg-----------catcagcagaacagaaatcaag
A0A669PL85_BMF-02       tccacatacagc---gggtagggtgtttcctcaggggaa-----------
A0A669QIC6_PMAIP1-      ----cctacggc---agaagg------tcctga-----------------
A0A669QMB4_BCL2L11      gcctcctattgtccaagaagggtaattttctta-----------------
                            * **  *     *             * *                 

A0A669PL85_BMF-01       tgtggtggcagctttttctctttctacacaacttggccttaaatgtggag
A0A669PL85_BMF-02       ---ggtgg--ggtatttcttatccaagagtggtgctccagaagactggct
A0A669QIC6_PMAIP1-      --------------acctcatcgcgaaactcttctgccccaaaa------
A0A669QMB4_BCL2L11      --------------tttttactttccatttctttacccactaaagcacca
                                                        *   **   *        

A0A669PL85_BMF-01       gcgaac--------aggaaccgcactgggcagaggtga
A0A669PL85_BMF-02       ccaggcttcagctaagcaatggcctagggcagccatag
A0A669QIC6_PMAIP1-      -------------------------cg--------tga
A0A669QMB4_BCL2L11      cctgtctctgggttagcagtgaactgg--------tga
                                                  *        *  

© 1998-2020Legal notice