Dataset for CDS BAD of organism Papio anubis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A096MLD5_BAD-01      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
A0A096MLD5_BAD-02      atgttccagatcccagagtttgagcctagtgagcaggaagactccagctc
                       **************************************************

A0A096MLD5_BAD-01      tgcagagaggggcctgggccccagccccgcgggggacaagccctcagact
A0A096MLD5_BAD-02      tgcagagaggggcctgggccccagccccgcgggggacaagccctcagact
                       **************************************************

A0A096MLD5_BAD-01      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
A0A096MLD5_BAD-02      ccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcac
                       **************************************************

A0A096MLD5_BAD-01      cagcaggagcagccaaccagcagcagccatcatgg---------------
A0A096MLD5_BAD-02      cagcaggagcagccaaccagcagcagccatcatggagggagagcttggta
                       ***********************************               

A0A096MLD5_BAD-01      --------------------------------------------------
A0A096MLD5_BAD-02      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
                                                                         

A0A096MLD5_BAD-01      --------------------------------------------------
A0A096MLD5_BAD-02      tcgcggaagcatcagcaccgatgtctgccccagccactgactcagaagcc
                                                                         

A0A096MLD5_BAD-01      -------------------------aggcgctggggctgtggagacgcgg
A0A096MLD5_BAD-02      caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacgcgg
                                                *************************

A0A096MLD5_BAD-01      agtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
A0A096MLD5_BAD-02      agtcgccacagctcctaccccgcggggacggaggaggacgaagggatgga
                       **************************************************

A0A096MLD5_BAD-01      ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacc
A0A096MLD5_BAD-02      ggaggagcccagcccctttcggggccgctcgcgctccgcgccccccaacc
                       **************************************************

A0A096MLD5_BAD-01      tctgggcagcacagcgttatggccgcgagctccggaggatgagtgacgag
A0A096MLD5_BAD-02      tctgggcagcacagcgttatggccgcgagctccggaggatga--------
                       ******************************************        

A0A096MLD5_BAD-01      tttgtggactcctttaagaagggacttcctcgcccgaagagcgcgggcac
A0A096MLD5_BAD-02      --------------------------------------------------
                                                                         

A0A096MLD5_BAD-01      agcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcct
A0A096MLD5_BAD-02      --------------------------------------------------
                                                                         

A0A096MLD5_BAD-01      ggtgggatcggaacttgggcaggggaagctccgccccctcccagtga
A0A096MLD5_BAD-02      -----------------------------------------------
                                                                      

© 1998-2020Legal notice