Dataset for CDS PMAIP1 of organism Panthera tigris altaica

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9J1B3_PMAIP1-      --------------tggtgttccttaagtattaagacagtcaaaatgagc
A0A8C9J1B3_PMAIP1-      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                                                                          

A0A8C9J1B3_PMAIP1-      cctgggagagtcccccccgaagtggaatgtgccatgcagctccggagatt
A0A8C9J1B3_PMAIP1-      nnnnnnnnag-----cccgaagtggaatgtgccatgcagctccggagatt
                                **     ***********************************

A0A8C9J1B3_PMAIP1-      tggagacaaactgaatttccgacagaagcttatgaatctgatatccaaac
A0A8C9J1B3_PMAIP1-      tggagacaaactgaatttccgacagaagcttatgaatctgatatccaaac
                        **************************************************

A0A8C9J1B3_PMAIP1-      tcttccgctcgggaacctga
A0A8C9J1B3_PMAIP1-      tcttccgctcgggaacctga
                        ********************

© 1998-2022Legal notice