Dataset for CDS BCL2L11 of organism Panthera leo

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C8Y6N0_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C8Y6N0_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C8Y6N0_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
A0A8C8Y6N0_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtgg
                        **************************************************

A0A8C8Y6N0_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A8C8Y6N0_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A8C8Y6N0_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
A0A8C8Y6N0_BCL2L11      acaattgcagcctgctgagaggcctcctcagctcaggcctggggccccta
                        **************************************************

A0A8C8Y6N0_BCL2L11      cctctctacagacagagcagcaa---------------------------
A0A8C8Y6N0_BCL2L11      cctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgc
A0A8C8Y6N0_BCL2L11      cctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgc
A0A8C8Y6N0_BCL2L11      cctctctacagacagagcagca----------------------------
                        **********************                            

A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
A0A8C8Y6N0_BCL2L11      tgcccccaaggcagccctcagggcccgctggccccaccagccagccccgg
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtcagaagatcctccc
A0A8C8Y6N0_BCL2L11      gccttttgctaccagatccccgcttttcatctttgtcagaagatcctccc
A0A8C8Y6N0_BCL2L11      --------------------------------------------------
                                                                          

A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C8Y6N0_BCL2L11      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
A0A8C8Y6N0_BCL2L11      ----------------------------------------agacaggagc
                                                                          

A0A8C8Y6N0_BCL2L11      --------------------------------------------------
A0A8C8Y6N0_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C8Y6N0_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
A0A8C8Y6N0_BCL2L11      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
                                                                          

A0A8C8Y6N0_BCL2L11      -------------------------------gcttccatgaggcagcctc
A0A8C8Y6N0_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
A0A8C8Y6N0_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
A0A8C8Y6N0_BCL2L11      ccaggccttcaaccattatctcagtgcaatggcttccatgaggcagcctc
                                                       *******************

A0A8C8Y6N0_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg
A0A8C8Y6N0_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg
A0A8C8Y6N0_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg
A0A8C8Y6N0_BCL2L11      aggctgtacccgcagatatgcgcccggagatatggattgcacaagagttg
                        **************************************************

A0A8C8Y6N0_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagg-----ctg
A0A8C8Y6N0_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagg-----tta
A0A8C8Y6N0_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagggtcttttt
A0A8C8Y6N0_BCL2L11      cggcgtatcggagacgaatttaatgcatattacccaaggagggtcttttt
                        ******************************************      * 

A0A8C8Y6N0_BCL2L11      gcaagagtaccg--------------------------------------
A0A8C8Y6N0_BCL2L11      gagcaatag-----------------------------------------
A0A8C8Y6N0_BCL2L11      gaataattaccaagcagccgaagcccagccccaaatgattatcttacgac
A0A8C8Y6N0_BCL2L11      gaataattaccaagcagccgaagcccagccccaaatgattatcttacgac
                        *    *                                            

A0A8C8Y6N0_BCL2L11      ---------gcatcctacatctga-----------------
A0A8C8Y6N0_BCL2L11      -----------------------------------------
A0A8C8Y6N0_BCL2L11      tgttacgttacatcgtccgcctgatatggcgattgcagcga
A0A8C8Y6N0_BCL2L11      tgttacgttacatcgtccgcctgatatggcgattgcagcga
                                                                 

© 1998-2022Legal notice