Dataset for CDS BCL2L11 of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1SSY0_BCL2L11-01      atggccaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
G1SSY0_BCL2L11-02      atggccaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
                       **************************************************

G1SSY0_BCL2L11-01      acagttgcagcctgcggagaggccgccccagctcaggcctggggccccca
G1SSY0_BCL2L11-02      acagttgcagcctgcggagaggccgccccagctcaggcctggggccccca
                       **************************************************

G1SSY0_BCL2L11-01      cctccctgcagtcggagccgca----------------------------
G1SSY0_BCL2L11-02      cctccctgcagtcggagccgcaaggtaatccggaaggcgaccgctgtgcg
                       **********************                            

G1SSY0_BCL2L11-01      --------------------------------------------------
G1SSY0_BCL2L11-02      cacggcagccctcagggcccgctggccccatcggccagccctggcccttt
                                                                         

G1SSY0_BCL2L11-01      --------------------------------------------------
G1SSY0_BCL2L11-02      cgctaccaggtccccgctcttcatctttgtccgaagatcctccctgctgt
                                                                         

G1SSY0_BCL2L11-01      ----------------------------------agacaggagcccggca
G1SSY0_BCL2L11-02      ctcgatcgtccagtgggtatttctcttttgacacagacaggagcccggca
                                                         ****************

G1SSY0_BCL2L11-01      cccatgagctgtgacaaatcaacacaaaccccaagtcctccttgccaggc
G1SSY0_BCL2L11-02      cccatgagctgtgacaaatcaacacaaaccccaagtcctccttgccaggc
                       **************************************************

G1SSY0_BCL2L11-01      cttcaaccactatctcagtgcaatgggtaagcaaagcctgggtaagacga
G1SSY0_BCL2L11-02      cttcaaccactatctcagtgcaatggcttccatgaggcagtctcaggctg
                       ************************** *      ** * *  * ** *  

G1SSY0_BCL2L11-01      agccagcatacgggtgtctgcatagctgtgt-------gtgtggcgtc--
G1SSY0_BCL2L11-02      aacctgcagacacgcgtccggagacctggatcgcgcaggagttgcggcgg
                       * ** *** **  * *** * * * ***  *       * ** *** *  

G1SSY0_BCL2L11-01      --------cacgtt--acgtgtattttacttttcctgaaaggtagaggtt
G1SSY0_BCL2L11-02      atcggagacgagttcaacgcgtattaccc----------acgcagggttt
                               *  ***  *** *****   *          * * ** * **

G1SSY0_BCL2L11-01      ttccatcagctggttgcttccccagatgcccaccacggcctggactggac
G1SSY0_BCL2L11-02      tt-------ttgaataattacccagcagc-----------------gga-
                       **        **  *  ** *****  **                 *** 

G1SSY0_BCL2L11-01      tgggccaggccaaagccaggagcctggaact-tggctctgagtctcccgc
G1SSY0_BCL2L11-02      -ggagcagccccaaatggttatcttgcgactgttgcgttacatcgtgcgc
                        **  *** ** **      * * **  *** * **  *   **   ***

G1SSY0_BCL2L11-01      ctgggtggcagggaccgagctag
G1SSY0_BCL2L11-02      ctgg--tgtggaggatgcattga
                       ****   *  * *   *   *  

© 1998-2020Legal notice