Dataset for CDS BCL2L11 of organism Oryctolagus cuniculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A5F9C9V3_BCL2L11      atggccaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
A0A5F9C9V3_BCL2L11      atggccaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg

A0A5F9C9V3_BCL2L11      acagttgcagcctgcggagaggccgccccagctcaggcctggggccccca
A0A5F9C9V3_BCL2L11      acagttgcagcctgcggagaggccgccccagctcaggcctggggccccca

A0A5F9C9V3_BCL2L11      cctccctgcagtcggagccgca----------------------------
A0A5F9C9V3_BCL2L11      cctccctgcagtcggagccgcaaggtaatccggaaggcgaccgctgtgcg

A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      cacggcagccctcagggcccgctggccccatcggccagccctggcccttt

A0A5F9C9V3_BCL2L11      --------------------------------------------------
A0A5F9C9V3_BCL2L11      cgctaccaggtccccgctcttcatctttgtccgaagatcctccctgctgt

A0A5F9C9V3_BCL2L11      ----------------------------------agacaggagcccggca
A0A5F9C9V3_BCL2L11      ctcgatcgtccagtgggtatttctcttttgacacagacaggagcccggca

A0A5F9C9V3_BCL2L11      cccatgagctgtgacaaatcaacacaaaccccaagtcctccttgccaggc
A0A5F9C9V3_BCL2L11      cccatgagctgtgacaaatcaacacaaaccccaagtcctccttgccaggc

A0A5F9C9V3_BCL2L11      cttcaaccactatctcagtgcaatgggtaagcaaagcctgggtaagacga
A0A5F9C9V3_BCL2L11      cttcaaccactatctcagtgcaatggcttccatgaggcagtctcaggctg
                        ************************** *      ** * *  * ** *  

A0A5F9C9V3_BCL2L11      agccagcatacgggtgtctgcatagctgtgt-------gtgtggcgtc--
A0A5F9C9V3_BCL2L11      aacctgcagacacgcgtccggagacctggatcgcgcaggagttgcggcgg
                        * ** *** **  * *** * * * ***  *       * ** *** *  

A0A5F9C9V3_BCL2L11      --------cacgtt--acgtgtattttacttttcctgaaaggtagaggtt
A0A5F9C9V3_BCL2L11      atcggagacgagttcaacgcgtattaccc----------acgcagggttt
                                *  ***  *** *****   *          * * ** * **

A0A5F9C9V3_BCL2L11      ttccatcagctggttgcttccccagatgcccaccacggcctggactggac
A0A5F9C9V3_BCL2L11      tt-------ttgaataattacccagcagc-----------------gga-
                        **        **  *  ** *****  **                 *** 

A0A5F9C9V3_BCL2L11      tgggccaggccaaagccaggagcctggaact-tggctctgagtctcccgc
A0A5F9C9V3_BCL2L11      -ggagcagccccaaatggttatcttgcgactgttgcgttacatcgtgcgc
                         **  *** ** **      * * **  *** * **  *   **   ***

A0A5F9C9V3_BCL2L11      ctgggtggcagggaccgagctag
A0A5F9C9V3_BCL2L11      ctgg--tgtggaggatgcattga
                        ****   *  * *   *   *  

© 1998-2021Legal notice