Dataset for CDS BAD of organism Oncorhynchus kisutch

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C7DT45_BAD-02      --------------------------------------------------
A0A8C7DT45_BAD-01      --------------------------------------------------
A0A8C7DT45_BAD-03      atgccaagactgagttggcctcctgagctaaagcttggtacaaagattca
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      --------------------------------------------------
A0A8C7DT45_BAD-01      --------------------------------------------------
A0A8C7DT45_BAD-03      gggtctattcagggtcaagcacatgtgtaataatgttgtcttcctctcct
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      --------------------------------------------------
A0A8C7DT45_BAD-01      --------------------------------------------------
A0A8C7DT45_BAD-03      ctctgcctcttttctctttctcccccctttctgccctctctccatccctc
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      --------------------------------------------------
A0A8C7DT45_BAD-01      --------------------------------------------------
A0A8C7DT45_BAD-03      ttcctctctctctgccctctctcgctcccctctctctctgccctctctcg
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      --------------------------------------------------
A0A8C7DT45_BAD-01      --------------------------------------------------
A0A8C7DT45_BAD-03      ctcccctctctctctctccatccctcttcctctctctctgccctctctct
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      --------------------------------------------------
A0A8C7DT45_BAD-01      --------------------------------------------------
A0A8C7DT45_BAD-03      ctccatccctcttcctctctctctgccctctctctctctctccatccctc
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      --------------------------------------------------
A0A8C7DT45_BAD-01      --------------------------------------------------
A0A8C7DT45_BAD-03      ttcctctctctctgccctctctctctctctccatccctcttcctctctct
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      --------------------------------------------------
A0A8C7DT45_BAD-01      --------------------------------------------------
A0A8C7DT45_BAD-03      ctgccctctctctctctctccatccctcttcccctctctctctgccctct
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      --------------------------------------------------
A0A8C7DT45_BAD-01      --------------------------------------------------
A0A8C7DT45_BAD-03      ctctctctctccatccctcttcccctctctctctccatccctcttcccct
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      --------------------------------------------------
A0A8C7DT45_BAD-01      --------------------------------------------------
A0A8C7DT45_BAD-03      ctctctctgccctctctcctctctctctgccctctctcctctctctctgc
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      --------------------------------------------------
A0A8C7DT45_BAD-01      --------------------------------------------------
A0A8C7DT45_BAD-03      cctctctccatctctctccatccctcttcccctctctctctccatccctc
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      --------------------------------------atggctcagatg
A0A8C7DT45_BAD-01      --------------------------------------atggctcagatg
A0A8C7DT45_BAD-03      ttcccctcctcactcactcttcctccatagatgtcagcatggctcagatg
A0A8C7KHU4_BAD-01      --------------------------------------atggaccacata
A0A8C7KKS5_BAD-01      --------------------------------------atgaat------
                                                             ***         

A0A8C7DT45_BAD-02      tttactatatcagaca---gcgagtcagagccctcagaggaggtaggaga
A0A8C7DT45_BAD-01      tttactatatcagaca---gcgagtcagagccctcagaggaggtaggaga
A0A8C7DT45_BAD-03      tttactatatcagaca---gcgagtcagagccctcagaggaggtaggaga
A0A8C7KHU4_BAD-01      catgattgtgtggatgaatgtgagtctgaccactc------------agg
A0A8C7KKS5_BAD-01      ------------gaacaagacgagtctgaccactc------------agg
                                   **       ***** ** * ***            ** 

A0A8C7DT45_BAD-02      aaccgaaaaggaccaatcgtctgccggaaaggggatgactggcggtccaa
A0A8C7DT45_BAD-01      aaccgaaaaggaccaatcgtctgccggaaaggggatgactggcggtccaa
A0A8C7DT45_BAD-03      aaccgaaaaggaccaatcgtctgccggaaaggggatgactggcggtccaa
A0A8C7KHU4_BAD-01      aaccacacacaactca--------------------gaatttcagctcc-
A0A8C7KKS5_BAD-01      aaccacacactaccca--------------------gaatttcagctcca
                       ****  * *  **  *                    ** *  * *  *  

A0A8C7DT45_BAD-02      taggccacgccctcactgtgcctgagatgagactggcaggagagggtcgg
A0A8C7DT45_BAD-01      taggccacgccctcactgtgcctgagatgagactggcaggagagggtcgg
A0A8C7DT45_BAD-03      taggccacgccctcactgtgcctgagatgagactggcaggagagggtcgg
A0A8C7KHU4_BAD-01      ------atgtctcaactacaatgagcaacagaccaagaccaggtgagcga
A0A8C7KKS5_BAD-01      ta----atgtctccgctacgacgagcatcagaccacgaccaggtgggcga
                             * * *    **         *  ****    *  **  *  ** 

A0A8C7DT45_BAD-02      ttgaggatgaactcagagtcccagg------cccag--------------
A0A8C7DT45_BAD-01      ttgaggatgaactcagagtcccagg------cccag--------------
A0A8C7DT45_BAD-03      ttgaggatgaactcagagtcccagg------cccag--------------
A0A8C7KHU4_BAD-01      gtccggctctactcagagtcccaggtgtgctcccaggttggaaaaaggga
A0A8C7KKS5_BAD-01      gctcggctctactccgagtcccaggtgtgctcccaggttggcagaaggga
                           ** *  **** **********      *****              

A0A8C7DT45_BAD-02      -------gagctccagggt----------------agggggccaggggtg
A0A8C7DT45_BAD-01      -------gagctccagggt----------------agggggccaggggtg
A0A8C7DT45_BAD-03      -------gagctccagggt----------------agggggccaggggtg
A0A8C7KHU4_BAD-01      agacacagagtttctggatgtgatgactcctactgaggatggcgggggt-
A0A8C7KKS5_BAD-01      tgacacagagtttcaggatgcaataactcctactgaggagggcgggggc-
                              *** * * ** *                ***  * * ****  

A0A8C7DT45_BAD-02      gaaggcatgcccacagacggagcatctttccggggtcgctcccagtcggc
A0A8C7DT45_BAD-01      gaaggcatgcccacagacggagcatctttccggggtcgctcccagtcggc
A0A8C7DT45_BAD-03      gaaggcatgcccacagacggagcatctttccggggtcgctcccagtcggc
A0A8C7KHU4_BAD-01      ---------------gacggggcttcattccgaggccgatcacagtctgc
A0A8C7KKS5_BAD-01      ---------------gatggggctcctttccgaagccgatcacagtctgc
                                      ** ** **  * *****  * ** ** ***** **

A0A8C7DT45_BAD-02      cccccctgccctctgggcggccaagagatacgggcggcagctccgacgca
A0A8C7DT45_BAD-01      cccccctgccctctgggcggccaagagatacgggcggcagctccgacgca
A0A8C7DT45_BAD-03      cccccctgccctctgggcggccaagagatacgggcggcagctccgacgca
A0A8C7KHU4_BAD-01      tcctcctgcactgtgggctgcaaagaaatatggctgccagctgaggagga
A0A8C7KKS5_BAD-01      tcctcctacactgtgggctgcaaagaaatatggccgccagctgaggagga
                        ** *** * ** ***** ** **** *** **  * *****  *  * *

A0A8C7DT45_BAD-02      tgagtgacgagttcgatacgtggctggataaaggggagatgaggcgggtg
A0A8C7DT45_BAD-01      tgagtgacgagttcgatacgtggctggataaa-gggaggtgctac-tgca
A0A8C7DT45_BAD-03      tgagtgacgagttcgatacgtggctggataaaggggagatgaggcgggtg
A0A8C7KHU4_BAD-01      tgagtgatgaatttgacacctggctcgacaaaggggagcccaagagaggg
A0A8C7KKS5_BAD-01      tgagtgatgaatttgacacctggctcgacaaaggggagcccaagagaggg
                       ******* ** ** ** ** ***** ** *** *****         *  

A0A8C7DT45_BAD-02      aagagtgcgggagcagccaaacagatgaccaagtcccccagct----ggt
A0A8C7DT45_BAD-01      aggtcttccgttgcagcccaa------atcaaccccctacacttccaggc
A0A8C7DT45_BAD-03      aagagtgcgggagcagccaaacagatgaccaagtcccccagct----ggt
A0A8C7KHU4_BAD-01      attagcccaggaggaggcaagcagaaagtc---tcccgaggat----ggt
A0A8C7KKS5_BAD-01      attagcccaggaggggtcaagcaggaggtc---tcccggggat----ggt
                       *      * *  *  * * *         *    ***     *    ** 

A0A8C7DT45_BAD-02      gggcctacctgttcagtcataaggagacagagagatggagaagggagagg
A0A8C7DT45_BAD-01      ggtccca-------attcat------------------------------
A0A8C7DT45_BAD-03      gggcctacctgttcagtcataaggagacagagacagaacata--------
A0A8C7KHU4_BAD-01      tctctttcctctggagtccaaaggaggcggaaggcagg------------
A0A8C7KKS5_BAD-01      tctctttcctctggagtccaaacgaggccgaaggcagg------------
                          *          * **                                

A0A8C7DT45_BAD-02      attggaaggcgggggggatgggcctacctgttctctcaccaagagacaac
A0A8C7DT45_BAD-01      ------------------------tccctatcccctc-------------
A0A8C7DT45_BAD-03      ------------------------cccctatcatccc-------------
A0A8C7KHU4_BAD-01      --------------------------------------------------
A0A8C7KKS5_BAD-01      --------------------------------------------------
                                                                         

A0A8C7DT45_BAD-02      ccaccgtaatcgtaccactattgaaccacggtcatcagagtacagagaag
A0A8C7DT45_BAD-01      ------------------------gatgttaggggctggatag-------
A0A8C7DT45_BAD-03      ------------------------accacgatcatctgagtag-------
A0A8C7KHU4_BAD-01      -------------------------------------gagtga-------
A0A8C7KKS5_BAD-01      -------------------------------------gagtga-------
                                                            *  *         

A0A8C7DT45_BAD-02      gggatgtttcccatgccaataaagccccttga
A0A8C7DT45_BAD-01      --------------------------------
A0A8C7DT45_BAD-03      --------------------------------
A0A8C7KHU4_BAD-01      --------------------------------
A0A8C7KKS5_BAD-01      --------------------------------
                                                       

© 1998-2022Legal notice