Dataset for CDS PMAIP1 of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I3HX97_PMAIP1-      -agcctgggagaagcgcgcaggaacgctcaaccgagccccgcgccggctc
A0A2I3HX97_PMAIP1-      aagcctgggag-agcgcgcaggaacgctcaaccgagccccgcgccggctc
                         ********** **************************************

A0A2I3HX97_PMAIP1-      cagcaggtaccgacccgctggggacggcggggacggcgaggaaccaagcc
A0A2I3HX97_PMAIP1-      cagcaga---------gctg------------------------------
                        ******          ****                              

A0A2I3HX97_PMAIP1-      ggatttgggattgggatgcagctgcgtttcaccaggggcaaaaagctcct
A0A2I3HX97_PMAIP1-      gaagttgagtgtgctactcaact---------caggag------------
                        * * *** *  **  *  ** **         **** *            

A0A2I3HX97_PMAIP1-      ctcctcctctctttcctcctcgccacttgcccttccccggggccacgagg
A0A2I3HX97_PMAIP1-      ------------------------atttg---------------------
                                                * ***                     

A0A2I3HX97_PMAIP1-      aacaagtgcaagtgagaacgtcattatcgcggcagaagggacaaactgaa
A0A2I3HX97_PMAIP1-      -------------------------------------gagacaaactgaa
                                                             * ***********

A0A2I3HX97_PMAIP1-      cttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
A0A2I3HX97_PMAIP1-      cttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa

A0A2I3HX97_PMAIP1-      cctgactgcatcaaaaacttgcatgaggggactccttcaaaagagttttc
A0A2I3HX97_PMAIP1-      cctga---------------------------------------------

A0A2I3HX97_PMAIP1-      tcaggaggcgcacatttcatcaatttgaagaaagattgcattgtaat
A0A2I3HX97_PMAIP1-      -----------------------------------------------

© 1998-2022Legal notice