Dataset for CDS BCL2L11 of organism Neovison vison

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


U6CTE3_BCL2L11-04      atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtgg
U6CTE3_BCL2L11-01      atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtgg
U6CTE3_BCL2L11-03      atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtgg
U6CTE3_BCL2L11-02      atggcaaagcaaccttcagatgtaagttctgagtgtgaccgagaaggtgg
                       **************************************************

U6CTE3_BCL2L11-04      acaattgcagcctgttgagaggcctcctcagctcaggcctggggccccta
U6CTE3_BCL2L11-01      acaattgcagcctgttgagaggcctcctcagctcaggcctggggccccta
U6CTE3_BCL2L11-03      acaattgcagcctgttgagaggcctcctcagctcaggcctggggccccta
U6CTE3_BCL2L11-02      acaattgcagcctgttgagaggcctcctcagctcaggcctggggccccta
                       **************************************************

U6CTE3_BCL2L11-04      cctctctacagacagagcagcaa---------------------------
U6CTE3_BCL2L11-01      cctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgc
U6CTE3_BCL2L11-03      cctctctacagacagagcagca----------------------------
U6CTE3_BCL2L11-02      cctctctacagacagagcagcaaggtaatcctgaaggcgaaggggaccgc
                       **********************                            

U6CTE3_BCL2L11-04      --------------------------------------------------
U6CTE3_BCL2L11-01      tgcccccaaggcagccctcagggcccactggccccacctgccagccccgg
U6CTE3_BCL2L11-03      --------------------------------------------------
U6CTE3_BCL2L11-02      tgcccccaaggcagccctcagggcccactggccccacctgccagccccgg
                                                                         

U6CTE3_BCL2L11-04      --------------------------------------------------
U6CTE3_BCL2L11-01      cccttttgctaccagatccccgcttttcatctttgtgagaagatcctccc
U6CTE3_BCL2L11-03      --------------------------------------------------
U6CTE3_BCL2L11-02      cccttttgctaccagatccccgcttttcatctttgtgagaagatcctccc
                                                                         

U6CTE3_BCL2L11-04      --------------------------------------------------
U6CTE3_BCL2L11-01      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
U6CTE3_BCL2L11-03      ----------------------------------------agacaggagc
U6CTE3_BCL2L11-02      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
                                                                         

U6CTE3_BCL2L11-04      --------------------------------------------------
U6CTE3_BCL2L11-01      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
U6CTE3_BCL2L11-03      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
U6CTE3_BCL2L11-02      ccggcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
                                                                         

U6CTE3_BCL2L11-04      -------------------------------gcttccaggaggcagtctc
U6CTE3_BCL2L11-01      ccaggccttcaaccattatctcagtgcaatggcttccaggaggcagtctc
U6CTE3_BCL2L11-03      ccaggccttcaaccattatctcagtgcaatggcttccaggaggcagtctc
U6CTE3_BCL2L11-02      ccaggccttcaaccattatctcagtgcaatggcttccaggaggcagtctc
                                                      *******************

U6CTE3_BCL2L11-04      aggctgtacctgcagatatgcgcccggagatgtggattgcgcaggagttg
U6CTE3_BCL2L11-01      aggctgtacctgcagatatgcgcccggagatgtggattgcgcaggagttg
U6CTE3_BCL2L11-03      aggctgtacctgcagatatgcgcccggagatgtggattgcgcaggagttg
U6CTE3_BCL2L11-02      aggctgtacctgcagatatgcgcccggagatgtggattgcgcaggagttg
                       **************************************************

U6CTE3_BCL2L11-04      cggcgtattggagacgagtttaatgcatattacccaaggaggct------
U6CTE3_BCL2L11-01      cggcgtattggagacgagtttaatgcatattacccaaggagggtcttttt
U6CTE3_BCL2L11-03      cggcgtattggagacgagtttaatgcatattacccaaggaggtt------
U6CTE3_BCL2L11-02      cggcgtattggagacgagtttaatgcatattacccaaggaggtt------
                       ****************************************** *      

U6CTE3_BCL2L11-04      --------------------------------------------------
U6CTE3_BCL2L11-01      gaataattacccagcagcagaagcccacccccaaatgattatcttacgac
U6CTE3_BCL2L11-03      --------------------------------------------------
U6CTE3_BCL2L11-02      --------------------------------------------------
                                                                         

U6CTE3_BCL2L11-04      ------------------------ggcaagaattccagcatcctgcctct
U6CTE3_BCL2L11-01      tgttacgttacatcatccgcctggtgtggagattgcagtga---------
U6CTE3_BCL2L11-03      -----------------------------aga--gcaatag---------
U6CTE3_BCL2L11-02      -----------------------------aga--gcaatag---------
                                                      *   **             

U6CTE3_BCL2L11-04      gc
U6CTE3_BCL2L11-01      --
U6CTE3_BCL2L11-03      --
U6CTE3_BCL2L11-02      --
                         

© 1998-2020Legal notice