Dataset for CDS BMF of organism Nannospalax galili

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6R2L6_BMF-01      atgccccgagcgggcgtattttggaaacaataccgcgcgctgagccgtgg
A0A8C6R2L6_BMF-02      -----------------atttt----------------------------
                                        *****                            

A0A8C6R2L6_BMF-01      cctcctcccgcgccagctcgtgccggcagccgccgctgccgcaccctgcg
A0A8C6R2L6_BMF-02      --------------------------------------------------
                                                                         

A0A8C6R2L6_BMF-01      ccacccgcctcccgccgcacccccgattgctcgtcacgctggaccctggt
A0A8C6R2L6_BMF-02      --------------------------------------------------
                                                                         

A0A8C6R2L6_BMF-01      gcagagccctggcatcacgactcggaagctgagactcactcctggagtca
A0A8C6R2L6_BMF-02      --------------------------------------------------
                                                                         

A0A8C6R2L6_BMF-01      cccaggagaaatggagccacctcagtgtgtggaggagctggaagatgatg
A0A8C6R2L6_BMF-02      cccaggagaaatggagccacctcagtgtgtggaggagctggaagatgatg
                       **************************************************

A0A8C6R2L6_BMF-01      tgtttcagccagaagatggggagccagggacacagtctgggagtttgctc
A0A8C6R2L6_BMF-02      tgtttcagccagaagatggggagccagggacacagtctgggagtttgctc
                       **************************************************

A0A8C6R2L6_BMF-01      tctgctgacctgtttgcccagagccagctggattgccccctcagccggct
A0A8C6R2L6_BMF-02      tctgctgacctgtttgcccagagccagctggattgccccctcagccggct
                       **************************************************

A0A8C6R2L6_BMF-01      tcagctcttccctcttacccactgctgtggccctgggctccggcccatta
A0A8C6R2L6_BMF-02      tcagctcttccctcttacccactgctgtggccctgggctccggcccatta
                       **************************************************

A0A8C6R2L6_BMF-01      gccaggaagacaaggccactcagaccctcagtccagcctccccaagccag
A0A8C6R2L6_BMF-02      gccaggaagacaaggccactcagaccctcagtccagcctccccaagccag
                       **************************************************

A0A8C6R2L6_BMF-01      ggtgtcatgctgccttgtggggtgacagaggaaccccaacgactctttta
A0A8C6R2L6_BMF-02      ggtgtcatgctgccttgtggggtgacagaggaaccccaacgactctttta
                       **************************************************

A0A8C6R2L6_BMF-01      cggcaatgctggctaccgacttcctctccctaccagtttccctgcaggct
A0A8C6R2L6_BMF-02      cggcaatgctggctaccgacttcctctccctaccagtttccctgcaggct
                       **************************************************

A0A8C6R2L6_BMF-01      tgccccttggggagcaggctcctgaagggcagtggcaacatcgagccgag
A0A8C6R2L6_BMF-02      tgccccttggggagcaggctcctgaagggcagtggcaacatcgagccgag
                       **************************************************

A0A8C6R2L6_BMF-01      gtacagatcgccagaaagcttcagtgcattgcagaccagttccaccggct
A0A8C6R2L6_BMF-02      gtacagatcgccagaaagcttcagtgcattgcagaccagttccaccggct
                       **************************************************

A0A8C6R2L6_BMF-01      ccatatgcagcaataccagcagaaccgagaccgagcatggtggcaggtct
A0A8C6R2L6_BMF-02      ccatatgcagcaataccagcagaaccgagaccgagcatggtggcaggtct
                       **************************************************

A0A8C6R2L6_BMF-01      tcctattcctgcacaacctggccttgaacagagaaggaaacagggatggg
A0A8C6R2L6_BMF-02      tcctattcctgcacaacctggccttgaacagagaaggaaacagggatggg
                       **************************************************

A0A8C6R2L6_BMF-01      gcaggtcccaggtga
A0A8C6R2L6_BMF-02      gcaggtcccaggtga
                       ***************

© 1998-2022Legal notice