Dataset for CDS BMF of organism Naja naja

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6VCH5_BMF-01      atgcaagggcaagaaataggtgaaatggatcctcctgtttacctggaaga
A0A8C6VCH5_BMF-02      ------------------------atggatcctcctgtttacctggaaga
A0A8C6VCH5_BMF-03      ------------------------atggatcctcctgtttacctggaaga
                                               **************************

A0A8C6VCH5_BMF-01      cgatttttcccatttggatgggttagatgatgatgtattccactctgacg
A0A8C6VCH5_BMF-02      cgatttttcccatttggatgggttagatgatgatgtattccactctgacg
A0A8C6VCH5_BMF-03      cgatttttcccatttggatgggttagatgatgatgtattccactctgacg
                       **************************************************

A0A8C6VCH5_BMF-01      actgtgaactcgtcagtcagtccagcaagatggcctttcgtggcattttc
A0A8C6VCH5_BMF-02      actgtgaactcgtcagtcagtccagcaagatggcctttcgtggcattttc
A0A8C6VCH5_BMF-03      actgtgaactcgtcagtcagtccagcaagatggcctttcgtggcattttc
                       **************************************************

A0A8C6VCH5_BMF-01      acccaaagcaaatcttacaactgcctcctgggcaggttccagctcttccc
A0A8C6VCH5_BMF-02      acccaaagcaaatcttacaactgcctcctgggcaggttccagctcttccc
A0A8C6VCH5_BMF-03      acccaaagcaaatcttacaactgcctcctgggcaggttccagctcttccc
                       **************************************************

A0A8C6VCH5_BMF-01      acttacgcactgttgtggcccaggcagcaggcatgccaaacaacaggaca
A0A8C6VCH5_BMF-02      acttacgcactgttgtggcccaggcagcaggcatgccaaacaacaggaca
A0A8C6VCH5_BMF-03      acttacgcactgttgtggcccaggcagcaggcatgccaaacaacaggaca
                       **************************************************

A0A8C6VCH5_BMF-01      aggcaacacagaccctcaatgcatcctcttccagccaggatatcatgtta
A0A8C6VCH5_BMF-02      aggcaacacagaccctcaatgcatcctcttccagccaggatatcatgtta
A0A8C6VCH5_BMF-03      aggcaacacagaccctcaatgcatcctcttccagccaggatatcatgtta
                       **************************************************

A0A8C6VCH5_BMF-01      ccttgcggagtcactgaagagcctcagagactcttttatggaaacgctgg
A0A8C6VCH5_BMF-02      ccttgcggagtcactgaagagcctcagagactcttttatggaaacgctgg
A0A8C6VCH5_BMF-03      ccttgcggagtcactgaagagcctcagagactcttttatggaaacgctgg
                       **************************************************

A0A8C6VCH5_BMF-01      ataccgtttacatgtccaaccaatcggtttcacattgaatccacatctcc
A0A8C6VCH5_BMF-02      ataccgtttacatgtccaaccaatcggtttcacattgaatccacatctcc
A0A8C6VCH5_BMF-03      ataccgtttacatgtccaaccaatcggtttcacattgaatccacatctcc
                       **************************************************

A0A8C6VCH5_BMF-01      aggaggaacctcaggaaagtctgcaggaattgcgtaccgaagttcagatt
A0A8C6VCH5_BMF-02      aggaggaacctcaggaaagtctgcaggaattgcgtaccgaagttcagatt
A0A8C6VCH5_BMF-03      aggaggaacctcaggaaagtctgcaggaattgcgtaccgaagttcagatt
                       **************************************************

A0A8C6VCH5_BMF-01      gcacggaagttacagtgcattgcagatcagttccacaggcttcatctaca
A0A8C6VCH5_BMF-02      gcacggaagttacagtgcattgcagatcagttccacaggcttcatctaca
A0A8C6VCH5_BMF-03      gcacggaagttacagtgcattgcagatcagttccacaggcttcatctaca
                       **************************************************

A0A8C6VCH5_BMF-01      gaggcacctgctctggaccattgaggggtctgcagcagccattcataact
A0A8C6VCH5_BMF-02      gaggcacctgctctggaccattgaggggtctgcagcagccattcataact
A0A8C6VCH5_BMF-03      gagg----------------------------------------------
                       ****                                              

A0A8C6VCH5_BMF-01      tggcggtctctagatatgtccaccagcagaacagaaatcaggtctggtgg
A0A8C6VCH5_BMF-02      tggcggtctctagatatgtccaccagcagaacagaaatcaggtctggtgg
A0A8C6VCH5_BMF-03      --------------------caccagcagaacagaaatcaggtctggtgg
                                           ******************************

A0A8C6VCH5_BMF-01      cagatccttctcttcctccataacttggccttgaacgtggaagccaacag
A0A8C6VCH5_BMF-02      cagatccttctcttcctccataacttggccttgaacgtggaagccaacag
A0A8C6VCH5_BMF-03      cagatccttctcttcctccataacttggccttgaacgtggaagccaacag
                       **************************************************

A0A8C6VCH5_BMF-01      acaacgtgtgggtcagaggtga
A0A8C6VCH5_BMF-02      acaacgtgtgggtcagaggtga
A0A8C6VCH5_BMF-03      acaacgtgtgggtcagaggtga
                       **********************

© 1998-2022Legal notice