Dataset for CDS classical BH3-containing proteins of organism Myotis lucifugus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1P8F9_PMAIP1-01       --------------------------atgcccgg----------------
G1PDJ5_BCL2L11-01      tccatgcagca---------------gtctcagg----------------
G1P8C5_BAD-01          --cctacagcccagagcatgttccagatcccagagtttgagcacagtgag
G1PAU1_BMF-01          ---atggagcc---------------acctcagtgtgtg-----gaggag
                                                     * *                 

G1P8F9_PMAIP1-01       ---gaagaag---------------gcgcgtaagaacgcgcagcctagcc
G1PDJ5_BCL2L11-01      -------------------------------------------ccctacc
G1P8C5_BAD-01          caggaaga-------ctccagccctgcagataggggcctgggcccctgcc
G1PAU1_BMF-01          ctggaggatgatgtgtttcagcca-gaggat--gagctggggacccagcc
                                                                  **   **

G1P8F9_PMAIP1-01       c-------gacgcgggccccg-----------------------------
G1PDJ5_BCL2L11-01      t----gtagacatgcgtccgg-----------------------------
G1P8C5_BAD-01          ccacaggggaccagcccccaggcctcaacaagcactggagtacggtccca
G1PAU1_BMF-01          t----gggagtttgccctctg-------------ctga---------cct
                                    *    * *                             

G1P8F9_PMAIP1-01       ---------gcagaggctgaaa----------------------------
G1PDJ5_BCL2L11-01      --------------agatg-------------------------------
G1P8C5_BAD-01          ggtctcctgggggaagctggtcaccagcagggccagccggccagcagcag
G1PAU1_BMF-01          gtttgcccagagccagctggac-------tgccccctcagccgtctgcag
                                      * **                               

G1P8F9_PMAIP1-01       ----------------------------ttgagtgt--------------
G1PDJ5_BCL2L11-01      -----------------------------tggatcg--------------
G1P8C5_BAD-01          --------------ccaccatgacggcgctgggtct--------------
G1PAU1_BMF-01          ctcttccctctcacccactgctgtggccctgggcttcgacccatcagcca

G1P8F9_PMAIP1-01       ---------------------------------gcccttcaa---ttaag
G1PDJ5_BCL2L11-01      -------------------------------------ctcaggagctgcg
G1P8C5_BAD-01          -----gtggagccgcggagtcgccacagctcgtaccccacggggaccgag
G1PAU1_BMF-01          ggaagacaaggccacccagac-cctcagtccagcctccccgag--ccagg
                                                              *         *

G1P8F9_PMAIP1-01       gag-------------------aattggaga---caagctgagt--ttcc
G1PDJ5_BCL2L11-01      gcg-------------------gatcgggga---cgagttcaacaactcc
G1P8C5_BAD-01          gag-----------gatgacgacaccgaggagggggagcccagc--ccct
G1PAU1_BMF-01          gtgtcatgctgccttgtggggtgaccgagga-----accccagcgactct
                       * *                    *  *  **     *    *      * 

G1P8F9_PMAIP1-01       tgc-----------------------------------------------
G1PDJ5_BCL2L11-01      tac-----------------------------------------------
G1P8C5_BAD-01          tccgcggc--cgctcgcgttcagcgcccc-------caaacctctgggca
G1PAU1_BMF-01          tttatggcaatgctggctaccggctccctctccctgccagtttccctgca

G1P8F9_PMAIP1-01       ----------------agaaacttctgaa---------------------
G1PDJ5_BCL2L11-01      ----------------cgcaacccacggagg-------------------
G1P8C5_BAD-01          gcacagcgctacggc-cgcgagctccggaggatgagcgac----------
G1PAU1_BMF-01          ggctcgccccttggtgagcagcccccggaaggacagtggcaacatcatcg
                                        *        * *                     

G1P8F9_PMAIP1-01       --------------------------------------------------
G1PDJ5_BCL2L11-01      ----gactttctgaatgtttaccgggaagcagaaggccacccc-------
G1P8C5_BAD-01          ----gagttccagggct----cctttaag---aagggtctccctcgcccg
G1PAU1_BMF-01          agcagagatccagatcg----ccagaaagcttcagagtattgccgacc--

G1P8F9_PMAIP1-01       --------------------------------------------------
G1PDJ5_BCL2L11-01      ----------------------------------------------caga
G1P8C5_BAD-01          aagagcgctggc-------acagcaacgcagatgtggcaaaagtc-cagc
G1PAU1_BMF-01          aatttcatcggcttcaaatgcagcaacaccagcagaaccgaaatcgcatg

G1P8F9_PMAIP1-01       -------------------tctgatgtacaaactctttggctcaggaa--
G1PDJ5_BCL2L11-01      tggtggt-cttacgactgttgcgttacatcctccgtctgg-tgtggagga
G1P8C5_BAD-01          tggacgcgctttttccagtcctggtgggatcggaactcgg--ggagagga
G1PAU1_BMF-01          tggtggcagttcctcctcttcctacataacctcgccttgaatggagatga
                                                             *      **   

G1P8F9_PMAIP1-01       -----------------------cctga
G1PDJ5_BCL2L11-01      g----------------------gatg-
G1P8C5_BAD-01          g-------gctccgccccctcccagtga
G1PAU1_BMF-01          gaacaggaacggggccggtcccaggtga

© 1998-2022Legal notice