Dataset for CDS BIK of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

O70337_BIK-02      atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtc
O70337_BIK-01      atgtcggaggcgagacttatggccagagacgtcatcaagactgttccacacgaccaggtc
O70337_BIK-04      atgtt-------------------------------------------cac---------
                   ****                                            ***         

O70337_BIK-02      ccccaacctccagtggcctctgagactcccagcatgaaggagcctgtgagagacgtggac
O70337_BIK-01      ccccaacctccagtggcctctgagactcccagcatgaaggagcctgtgagagacgtggac
O70337_BIK-04      ------------------------------------------------------------

O70337_BIK-02      ctcatggagtgcgtggaaggcagaaaccaggtggccttgaggctggcctgcatcggcgat
O70337_BIK-01      ctcatggagtgcgtggaaggcagaaaccaggtggccttgaggctggcctgcatcggcgat
O70337_BIK-04      --------------------cagaaaccaggtggccttgaggctggcctgcatcggcgat

O70337_BIK-02      gagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
O70337_BIK-01      gagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac
O70337_BIK-04      gagatggacctgtgtctgcggagcccccgtctggtccagctgcctgggattgctatacac

O70337_BIK-02      agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcga
O70337_BIK-01      agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcga
O70337_BIK-04      agactcgctgtcacctacagccggacaggtgtcagaggtattttcaggagcttgattcga

O70337_BIK-02      agcctcaccaacctcagggaaaacatctggtcctggagagtcttgactcctggcgcctgg
O70337_BIK-01      agcctcaccaacctcagggaaaacatctggtcctggagagtcttgactcctggcgcctgg
O70337_BIK-04      agcctcaccaacctcagggaaaacatctggtcctggagagtcttgactcctggcgcctgg

O70337_BIK-02      gtgtcacctgaccaggaccctgggcagctgtttccgatggtgctgctggtcttcttgctg
O70337_BIK-01      gtgtcacctgaccaggaccctgggcagctgtttccgatggtgctgctggtcttcttgctg
O70337_BIK-04      gtgtcacctgaccaggaccctgggcagctgtttccgatggtgctgctggtcttcttgctg

O70337_BIK-02      ctgggtggggcctggtatttgcagcttcagtga
O70337_BIK-01      ctgggtggggcctggtatttgcagcttcagtga
O70337_BIK-04      ctgggtggggcctggtatttgcagcttcagtga

© 1998-2020Legal notice