Dataset for CDS BCL2L11 of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A5F8H037_BCL2L11      atggcaaaacaaccgtcagatctaaattctgagtgtgacagagaaggtgg
A0A5F8H037_BCL2L11      atggcaaaacaaccgtcagatctaaattctgagtgtgacagagaaggtgg

A0A5F8H037_BCL2L11      acaattgcagcctacagaaaggcctactcagcctcaacaactcagaccag
A0A5F8H037_BCL2L11      acaattgcagcctacagaaaggcctactcagcctcaacaactcagaccag

A0A5F8H037_BCL2L11      gggcccctacctctatacaaacacagtatca-------------------
A0A5F8H037_BCL2L11      gggcccctacctctatacaaacacagtatcaaggtaattcaggtgaaggg

A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      gacagctgctcacccagcagtcctcagggaccgtttgcaccacccactag

A0A5F8H037_BCL2L11      --------------------------------------------------
A0A5F8H037_BCL2L11      ccctagtccatttgctaccagatccccacttttcatctttttaagaagat

A0A5F8H037_BCL2L11      ----------------------------------------------agac
A0A5F8H037_BCL2L11      ctccactgctgcctcgatcttccagtgggtatttctcttttgacacagac

A0A5F8H037_BCL2L11      aggagtccagcgcctatgagttgtgataaatctacacaaactccaagccc
A0A5F8H037_BCL2L11      aggagtccagcgcctatgagttgtgataaatctacacaaactccaagccc

A0A5F8H037_BCL2L11      tccttgtcaagccttcaatcattatctaagtgcaatg-------------
A0A5F8H037_BCL2L11      tccttgtcaagccttcaatcattatctaagtgcaatgggtaagcaagatc

A0A5F8H037_BCL2L11      --gcttccatgaggcagtctcaatcaatacctgcagatatgcggccagaa
A0A5F8H037_BCL2L11      atgcttccatgaggcagtctcaatcaatacctgcagatatgcggccagaa

A0A5F8H037_BCL2L11      atttggattgcacaagaattgcgccgtattggagatgaatttaatgcttc
A0A5F8H037_BCL2L11      atttggattgcacaagaattgcgccgtattggagatgaatttaatgcttc

A0A5F8H037_BCL2L11      ctattatccaagaagg---------------------------gcag---
A0A5F8H037_BCL2L11      ctattatccaagaagggggtttttggataataactatcaaggagcaggtg
                        ****************                           ****   

A0A5F8H037_BCL2L11      ---------------------------tgtggcattgtttcaagagcttt
A0A5F8H037_BCL2L11      accatcaccaaatggttattttacgcctgttacgttacatcatccgcctt
                                                   ***  * **   ***   ** **

A0A5F8H037_BCL2L11      gggattggagttggaagtcagctttga
A0A5F8H037_BCL2L11      ---------gtttggagaatgcagtga
                                 *** * **   **  ***

© 1998-2022Legal notice