Dataset for CDS BCL2L11 of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7CXT2_BCL2L11-02      atggcaaaacaaccgtcagatctaaattctgagtgtgacagagaaggtgg
F7CXT2_BCL2L11-01      atggcaaaacaaccgtcagatctaaattctgagtgtgacagagaaggtgg
                       **************************************************

F7CXT2_BCL2L11-02      acaattgcagcctacagaaaggcctactcagcctcaacaactcagaccag
F7CXT2_BCL2L11-01      acaattgcagcctacagaaaggcctactcagcctcaacaactcagaccag
                       **************************************************

F7CXT2_BCL2L11-02      gggcccctacctctatacaaacacagtatcaaggtaattcaggtgaaggg
F7CXT2_BCL2L11-01      gggcccctacctctatacaaacacagtatca-------------------
                       *******************************                   

F7CXT2_BCL2L11-02      gacagctgctcacccagcagtcctcagggaccgtttgcaccacccactag
F7CXT2_BCL2L11-01      --------------------------------------------------
                                                                         

F7CXT2_BCL2L11-02      ccctagtccatttgctaccagatccccacttttcatctttttaagaagat
F7CXT2_BCL2L11-01      --------------------------------------------------
                                                                         

F7CXT2_BCL2L11-02      ctccactgctgcctcgatcttccagtgggtatttctcttttgacacagac
F7CXT2_BCL2L11-01      ----------------------------------------------agac
                                                                     ****

F7CXT2_BCL2L11-02      aggagtccagcgcctatgagttgtgataaatctacacaaactccaagccc
F7CXT2_BCL2L11-01      aggagtccagcgcctatgagttgtgataaatctacacaaactccaagccc
                       **************************************************

F7CXT2_BCL2L11-02      tccttgtcaagccttcaatcattatctaagtgcaatgggtaagcaagatc
F7CXT2_BCL2L11-01      tccttgtcaagccttcaatcattatctaagtgcaatg-------------
                       *************************************             

F7CXT2_BCL2L11-02      atgcttccatgaggcagtctcaatcaatacctgcagatatgcggccagaa
F7CXT2_BCL2L11-01      --gcttccatgaggcagtctcaatcaatacctgcagatatgcggccagaa
                         ************************************************

F7CXT2_BCL2L11-02      atttggattgcacaagaattgcgccgtattggagatgaatttaatgcttc
F7CXT2_BCL2L11-01      atttggattgcacaagaattgcgccgtattggagatgaatttaatgcttc
                       **************************************************

F7CXT2_BCL2L11-02      ctattatccaagaagggggtttttggataataactatcaaggagcaggtg
F7CXT2_BCL2L11-01      ctattatccaagaagg---------------------------gcag---
                       ****************                           ****   

F7CXT2_BCL2L11-02      accatcaccaaatggttattttacgcctgttacgttacatcatccgcctt
F7CXT2_BCL2L11-01      ---------------------------tgtggcattgtttcaagagcttt
                                                  ***  * **   ***   ** **

F7CXT2_BCL2L11-02      ---------gtttggagaatgcagtga
F7CXT2_BCL2L11-01      gggattggagttggaagtcagctttga
                                *** * **   **  ***

© 1998-2020Legal notice