Dataset for CDS classical BH3-containing proteins of organism Mesocricetus auratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1U7QLK6_PMAIP1-      ---------------atgc-------------------------------
A0A1U8BW10_BCL2L11      ---------------atggccaagcaa--------------ccttctgat
A0A1U8BW10_BCL2L11      ---------------atggccaagcaa--------------ccttctgat
A0A1U8BW10_BCL2L11      ---------------atggccaagcaa--------------ccttctgat
A0A1U7R468_HRK-01       ---------------atgt-------------------------------
A0A1U7R5N5_BBC3-01      ---------------atggcccgcgcacgccaggagggcagctctccgga
A0A1U7Q4V0_BAD-01       ---------------atgg------gaaccccaaaacagccctcgctggc
A0A1U8CPE0_BMF-02       attttcccaggagagatgg------ag---cca-------cctcagtg--
A0A1U8CPE0_BMF-01       ---------------atgg------ag---cca-------cctcagtg--

A0A1U7QLK6_PMAIP1-      -----tccagagcgtag----cgcgtcagaacgcgccatcgaacccagcg
A0A1U8BW10_BCL2L11      gtaagttctgagtgtgacagagaaggtggacaa-----------ttgcag
A0A1U8BW10_BCL2L11      gtaagttctgagtgtgacagagaaggtggacaa-----------ttgcag
A0A1U8BW10_BCL2L11      gtaagttctgagtgtgacagagaaggtggacaa-----------ttgcag
A0A1U7R468_HRK-01       ----------------------------gcccgtgtccccggcatcgcgg
A0A1U7R5N5_BBC3-01      gcccgtagagggcttggcc--cgcgacagtccgcgccccttcccgctcgg
A0A1U7Q4V0_BAD-01       tcctgcacacgccctaggcg-tgaggaagtccg-atcccggaatccgaag
A0A1U8CPE0_BMF-02       ---tgtggaggagctggaagatgatgtgttcca-gtcagaggatggggag
A0A1U8CPE0_BMF-01       ---tgtggaggagctggaagatgatgtgttcca-gtcagaggatggggag

A0A1U7QLK6_PMAIP1-      c-------------------------------------------------
A0A1U8BW10_BCL2L11      cc------------------------------------------------
A0A1U8BW10_BCL2L11      cc------------------------------------------------
A0A1U8BW10_BCL2L11      cc------------------------------------------------
A0A1U7R468_HRK-01       cc---------ac---g---------------------------------
A0A1U7R5N5_BBC3-01      cc---------gcctgg---------------------------------
A0A1U7Q4V0_BAD-01       cctggggaacgacgcgggaggaaggcggcgaagaccagcagcccagagta
A0A1U8CPE0_BMF-02       ccagggacacaacctgg----------------------------gagct
A0A1U8CPE0_BMF-01       ccagggacacaacctgg----------------------------gagct

A0A1U7QLK6_PMAIP1-      ------------------------gggcagagctag--------------
A0A1U8BW10_BCL2L11      -----------------------tgctgaga-------------------
A0A1U8BW10_BCL2L11      -----------------------tgctgaga-------------------
A0A1U8BW10_BCL2L11      -----------------------tgctgaga-------------------
A0A1U7R468_HRK-01       ggcctccggccgtg---tgcggttgcggcga-------------------
A0A1U7R5N5_BBC3-01      tgccctccgctgtgtcctgcggcctctgcgagccc---------------
A0A1U7Q4V0_BAD-01       tgttc----cagatcccagagtttgagccgagtgagcaggaagactccaa
A0A1U8CPE0_BMF-02       tgctctctgctgaccc----gtttgcccagagccagctggattgtcc---
A0A1U8CPE0_BMF-01       tgctctctgctgaccc----gtttgcccagagccagctggattgtcc---

A0A1U7QLK6_PMAIP1-      -------------cgcctgagt--------------------------tc
A0A1U8BW10_BCL2L11      -------------ggcct------------------------------cc
A0A1U8BW10_BCL2L11      -------------ggcct------------------------------cc
A0A1U8BW10_BCL2L11      -------------ggcct------------------------------cc
A0A1U7R468_HRK-01       ------------------------------cactc-------------gc
A0A1U7R5N5_BBC3-01      -------------ggcctgcccgccgcccctgctg-------------cc
A0A1U7Q4V0_BAD-01       tactgcagataggggcctgggccctagcctcactggggacccaccaggtc
A0A1U8CPE0_BMF-02       --cctcagcc---ggcttcagctcttccct---------ctcac----tc
A0A1U8CPE0_BMF-01       --cctcagcc---ggcttcagctcttccct---------ctcac----tc

A0A1U7QLK6_PMAIP1-      atagctcaactccgg---------aggattggagacaaa-----------
A0A1U8BW10_BCL2L11      ccagctcaggcctggggcccctacctccctacagacaga-----------
A0A1U8BW10_BCL2L11      ccagctcaggcctggggcccctacctccctacagacaga-----------
A0A1U8BW10_BCL2L11      ccagctcaggcctggggcccctacctccctacagacaga-----------
A0A1U7R468_HRK-01       cccgggctgc-gctgggcggc---ggcacaggtgaccgc-----------
A0A1U7R5N5_BBC3-01      cccgccctgctgccggccgcc---tacctctgcgccccc-----------
A0A1U7Q4V0_BAD-01       cctgcctggctccaggtctcctggggaacatcagacaccaacaggaacag
A0A1U8CPE0_BMF-02       actgctgtggtcctgggctcc---ggcccataag------------ccag
A0A1U8CPE0_BMF-01       actgctgtggtcctgggctcc---ggcccataag------------ccag
                           *          *                  *                

A0A1U7QLK6_PMAIP1-      ----------------------ctgtcttctgagtggtgtgaacccgaca
A0A1U8BW10_BCL2L11      ----acagcaaggtaatcctgacggtgaaggggaccgctgcccccacggc
A0A1U8BW10_BCL2L11      ----acagca----------------------------------------
A0A1U8BW10_BCL2L11      ----acagca----------------------------------------
A0A1U7R468_HRK-01       ---------------------------------gctg---aggctg----
A0A1U7R5N5_BBC3-01      ---------------------------------accgccccgcccg----
A0A1U7Q4V0_BAD-01       gcagccaacagcagtcatcatggaggcactggggctatggagacccggag
A0A1U8CPE0_BMF-02       gaagacaa------------------------ggccacccagaccc----
A0A1U8CPE0_BMF-01       gaagacaa------------------------ggccacccagaccc----

A0A1U7QLK6_PMAIP1-      tcattgcggtgct-------------------------------------
A0A1U8BW10_BCL2L11      agcccgcagggcccgctggccccaccggccagccctggcccttctgctac
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U7R468_HRK-01       ------cag--------gcgc-----------------------------
A0A1U7R5N5_BBC3-01      ------ccgtcaccgccgccc-----------------------------
A0A1U7Q4V0_BAD-01       tcgccacagttcatacaccgc-----------------------------
A0A1U8CPE0_BMF-02       tcagcccagcctccccaagcc-----------------------------
A0A1U8CPE0_BMF-01       tcagcccagcctccccaagcc-----------------------------

A0A1U7QLK6_PMAIP1-      --------------------------------------------------
A0A1U8BW10_BCL2L11      cagatccccacttttcatctttgtgagaagatcttctctgctgtcccggt
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------

A0A1U7QLK6_PMAIP1-      ----------------------------ggcggagatgcctggcaagaag
A0A1U8BW10_BCL2L11      cctccagtgggtatttctcttttgacacagacaggagtccggcacccatg
A0A1U8BW10_BCL2L11      ----------------------------agacaggagtccggcacccatg
A0A1U8BW10_BCL2L11      ----------------------------agacaggagtccggcacccatg
A0A1U7R468_HRK-01       ----------------------------tgggcgacgagctgcaccgacg
A0A1U7R5N5_BBC3-01      ----------------------------tggggggc------ccccgctg
A0A1U7Q4V0_BAD-01       ----------------------------ggggaa--------cgaggagg
A0A1U8CPE0_BMF-02       ----------------------------agggtg--------ttatgctg
A0A1U8CPE0_BMF-01       ----------------------------agggtg--------ttatgctg
                                                     *                   *

A0A1U7QLK6_PMAIP1-      gctcgaaagagcgtgacgaggattccgagcccaacgcgg-----------
A0A1U8BW10_BCL2L11      agttgtgacaagtcaacacaaaccccaagtcctcctt-------------
A0A1U8BW10_BCL2L11      agttgtgacaagtcaacacaaaccccaagtcctcctt-------------
A0A1U8BW10_BCL2L11      agttgtgacaagtcaacacaaaccccaagtcctcctt-------------
A0A1U7R468_HRK-01       cgccatgcggcgccgcgcgcggccccgggacccgct--------------
A0A1U7R5N5_BBC3-01      gcctgggggtccccgcagccgaccccgaggcccacgcccggacggtcctc
A0A1U7Q4V0_BAD-01       -atgaagggatggaagaggagctc---agcccctttcgg-----------
A0A1U8CPE0_BMF-02       ccttgtggggtgacagaggaaccccagagactcttttac-----------
A0A1U8CPE0_BMF-01       ccttgtggggtgacagaggaaccccagagactcttttac-----------
                                                    * *                   

A0A1U7QLK6_PMAIP1-      --------------------------------------------------
A0A1U8BW10_BCL2L11      -gccaa----------------------------gccttcaa------cc
A0A1U8BW10_BCL2L11      -gccaa----------------------------gccttcaa------cc
A0A1U8BW10_BCL2L11      -gccaa----------------------------gccttcaa------cc
A0A1U7R468_HRK-01       -gcctgcgct------------------------gctgcccgcac---tc
A0A1U7R5N5_BBC3-01      agccctcgctgtcaccggcccagcagcacctagagtcgcccgtgc---cc
A0A1U7Q4V0_BAD-01       -ggc--cgctcgcgttcg----------------gctcccc-------cc
A0A1U8CPE0_BMF-02       -ggcaatgctggctacag----------------gcttcctctccctgcc
A0A1U8CPE0_BMF-01       -ggcaatgctggctacag----------------gcttcctctccctgcc

A0A1U7QLK6_PMAIP1-      ---gtcccaacagatgtg--------------------------------
A0A1U8BW10_BCL2L11      attatctcagt-gcaatggcttccataaggcagtctca------------
A0A1U8BW10_BCL2L11      attatctcagt-gcaatggcttccataaggcagtctca------------
A0A1U8BW10_BCL2L11      attatctcagt-gcaatgga-tctgtgtgagaatctta------------
A0A1U7R468_HRK-01       cgcg-cccgctggccctg----gctgtgcgcggccgcgc-----------
A0A1U7R5N5_BBC3-01      agcgccccggaggccctg----gcgg---gcggccccacccaagcagccc
A0A1U7Q4V0_BAD-01       aatctctgggctgcgcagcgctacggccgcgagctcc-------------
A0A1U8CPE0_BMF-02       agtttccccgcaggcttgcccctcggggagcagccccct-----------
A0A1U8CPE0_BMF-01       agtttccccgcaggcttgcccctcggggagcagccccct-----------
                             *      *    *                                

A0A1U7QLK6_PMAIP1-      -----------------gaagacgagtgtgttcatc--------------
A0A1U8BW10_BCL2L11      -------------ggaggaacctgcagatatccgcccggagatatggatt
A0A1U8BW10_BCL2L11      -------------ggaggaacctgcagatatccgcccggagatatggatt
A0A1U8BW10_BCL2L11      -------------ag-----------------------------------
A0A1U7R468_HRK-01       ---------------aggtggcggcgctggc----------------ggc
A0A1U7R5N5_BBC3-01      cgggagtgcgcggggaggaggaggagtgggcccggg----agatcggggc
A0A1U7Q4V0_BAD-01       -------------gaaggatgagcgatgagtttgag----ggttc----c
A0A1U8CPE0_BMF-02       -------------gaaggac-agtggcaacatcgagcagaggtacagatc
A0A1U8CPE0_BMF-01       -------------gaaggac-agtggcaacatcgagcagaggtacagatc

A0A1U7QLK6_PMAIP1-      -------aactccggaggattggagacaaa---cagaatttgcgg-----
A0A1U8BW10_BCL2L11      gcacaggagcttcggcggattggagacgagttcaacgaatcttac-----
A0A1U8BW10_BCL2L11      gcacaggagcttcggcggattggagacgagttcaacgaatcttac-----
A0A1U8BW10_BCL2L11      ---cacgag---tggcagattcatggtga--tcaa---------------
A0A1U7R468_HRK-01       ct-----ggctgc-tcggcaggcgg-----------agcgcgtag-----
A0A1U7R5N5_BBC3-01      tc-----agctgcggcggatggcggacg---acctcaacgcgcagtacga
A0A1U7Q4V0_BAD-01       ttcaagggacttcctcg--------------cccaaagagcgcag-----
A0A1U8CPE0_BMF-02       gccagaaagcttcagtgtattgctgaccagttccatcggctgcac-----
A0A1U8CPE0_BMF-01       gccagaaagcttcagtgtattgctgaccagttccatcggctgcac-----

A0A1U7QLK6_PMAIP1-      ----------------------------------------------caga
A0A1U8BW10_BCL2L11      ----agaaggagggtaaataattaccaagaggatgaagaccaccctcacc
A0A1U8BW10_BCL2L11      ----agaaggagggtaaataattaccaagaggatgaagaccaccctcacc
A0A1U8BW10_BCL2L11      ------------agtaaa--------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
A0A1U7R5N5_BBC3-01      gcggcggagacaagaagagcaacatcgacaccgcccgtcgccctggaggg
A0A1U7Q4V0_BAD-01       -------------ggactgcaacacagatgcgacaaagcgccagc-tgga
A0A1U8CPE0_BMF-02       -------------atacaacaacaccagcagaaccgagaccgtgcatggt
A0A1U8CPE0_BMF-01       -------------atacaacaacaccagcagaaccgagaccgtgcatggt

A0A1U7QLK6_PMAIP1-      aacttctgaattttatttccaagctctttagtttagtaa-----------
A0A1U8BW10_BCL2L11      accctcaaatggttatcttacaactgttacgctt------------catc
A0A1U8BW10_BCL2L11      accctcaaatggttatcttacaactgttacgctt------------catc
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
A0A1U7R5N5_BBC3-01      tcatgtacaatctcttcatgggactcctccccttacccagggatcctgga
A0A1U7Q4V0_BAD-01       cgcgcattatccagtcctggtgggatcgaaacttgggcaaaggaggctcc
A0A1U8CPE0_BMF-02       ggcaggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaac
A0A1U8CPE0_BMF-01       ggcaggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaac

A0A1U7QLK6_PMAIP1-      ----------------------cctga
A0A1U8BW10_BCL2L11      gtccgactagtatggagaaggcattga
A0A1U8BW10_BCL2L11      gtccgactagtatggagaaggcattga
A0A1U8BW10_BCL2L11      --------agt----------------
A0A1U7R468_HRK-01       ---------------------------
A0A1U7R5N5_BBC3-01      gccccagaaatggagcccaactag---
A0A1U7Q4V0_BAD-01       a------------ctccctcccaatga
A0A1U8CPE0_BMF-02       agggaaggggtgggtccct---ggtga
A0A1U8CPE0_BMF-01       agggaaggggtgggtccct---ggtga

© 1998-2020Legal notice