Dataset for CDS BMF of organism Mastacembelus armatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3RVI2_BMF-02      atggacgatgaggaggatgatgtgtttgagccagacccccacttctggcg
A0A3Q3RVI2_BMF-01      atggacgatgaggaggatgatgtgtttgagccagacccccacttctggcg
                       **************************************************

A0A3Q3RVI2_BMF-02      caccacgttcagggagataaagtgtgaagaccggggcacacagacacctg
A0A3Q3RVI2_BMF-01      caccacgttcagggagataaagtgtgaagaccggggcacacagacacctg
                       **************************************************

A0A3Q3RVI2_BMF-02      gccctgccttggcgctgaacaacggcatgctgccctgtggagtcgcagag
A0A3Q3RVI2_BMF-01      gccctgccttggcgctgaacaacggcatgctgccctgtggagtcgcagag
                       **************************************************

A0A3Q3RVI2_BMF-02      gagccaagaccactcttctacggcaacgcaggttttcgattgcacttccc
A0A3Q3RVI2_BMF-01      gagccaagaccactcttctacggcaacgcaggttttcgattgcacttccc
                       **************************************************

A0A3Q3RVI2_BMF-02      ggcacattttgaacttgttggggatcaggaagtgaggcaacaagaaagag
A0A3Q3RVI2_BMF-01      ggcacattttgaacttgttggggatcaggaagtgaggcaacaagaaagag
                       **************************************************

A0A3Q3RVI2_BMF-02      aagaggagcaaaacaggatggagcagctacccaggcagcaacctctcgtg
A0A3Q3RVI2_BMF-01      aagaggagcaaaacaggatggagcagctacccaggcagcaacctctcgtg
                       **************************************************

A0A3Q3RVI2_BMF-02      cacagtgtggaggcgtgtattggccagaaactccagctgataggagacca
A0A3Q3RVI2_BMF-01      cacagtgtggaggcgtgtattggccagaaactccagctgataggagacca
                       **************************************************

A0A3Q3RVI2_BMF-02      atttcaccgagaacacttgcaactgta--tcatctaaaccaaaggaacca
A0A3Q3RVI2_BMF-01      atttcaccgagaacacttgcaactgcaggttggctgggcgccagagacgt
                       ************************* *  *   **   *   **  **  

A0A3Q3RVI2_BMF-02      ggggctgctgtggtggcgcctggccacagctctgctcagcctactgtttg
A0A3Q3RVI2_BMF-01      caggcagtt-------tgcctg--------tcttgttagc---atgcctc
                         *** * *        *****        ***  * ***    **  * 

A0A3Q3RVI2_BMF-02      acagagggttcattgctggaggaggcagagcaggacggaggtga
A0A3Q3RVI2_BMF-01      acc-----ttgataacaggagtgtggagagaggga------tga
                       **      ** **  * ****   * ****  ***      ***

© 1998-2020Legal notice