Dataset for CDS BCL2L11 of organism Mandrillus leucophaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5Z7V3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5Z7V3_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K5Z7V3_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5Z7V3_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A2K5Z7V3_BCL2L11      cctccctacagacagagccaca----------------------------
A0A2K5Z7V3_BCL2L11      cctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggt
                        **********************                            

A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                                                                          

A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
                                                                          

A0A2K5Z7V3_BCL2L11      --------------------------------------------------
A0A2K5Z7V3_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                                                                          

A0A2K5Z7V3_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5Z7V3_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                          ************************************************

A0A2K5Z7V3_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggt-----
A0A2K5Z7V3_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
                        ********************************************      

A0A2K5Z7V3_BCL2L11      --agtcattctaga-----------------ggatataggtgatagttca
A0A2K5Z7V3_BCL2L11      ggaggcaggctgaacctgcagatatgcgcccggagatacg-gatcgccca
                          ** **  **  *                 *** *** * *** *  **

A0A2K5Z7V3_BCL2L11      ttgtttg-----------------gatttatatttact--------ggct
A0A2K5Z7V3_BCL2L11      agagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggg
                            ***                 * ** *   *****         *  

A0A2K5Z7V3_BCL2L11      tagatttgtatggccaccaccacagtcaagatacagaacaactcaaccac
A0A2K5Z7V3_BCL2L11      tatttttgaataattacca-agcagccga----------agaccacccac
                        **  **** **    ****   *** * *          *   ** ****

A0A2K5Z7V3_BCL2L11      aa--ggatttctcatga---------------------------------
A0A2K5Z7V3_BCL2L11      aaatggttatcttacgactgttgcgttacattgtccgcctggtgtggaga
                        **  ** * *** * **                                 

A0A2K5Z7V3_BCL2L11      ---------
A0A2K5Z7V3_BCL2L11      atgcattga
                                 

© 1998-2020Legal notice