Dataset for CDS BBC3 of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6ASP2_BBC3-02      ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccag
A0A2K6ASP2_BBC3-01      ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccag
A0A2K6ASP2_BBC3-03      ataaaatttggcgtggggtctgcccgggcatgtccatgccaggtgcccag

A0A2K6ASP2_BBC3-02      ggcttcttctgcgacgtgggtcccctgccagatttgt-------------
A0A2K6ASP2_BBC3-01      ggcttcttctgcgacgtgggtcccctgccagatttgtggccccagggagc
A0A2K6ASP2_BBC3-03      ggcttcttctgcgacgtgggtcccctgccagatttgt-------------

A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gccatggcccgcgcacgccaggagggcagctccccggagcccgtagaggg
A0A2K6ASP2_BBC3-03      --------------------------------------------------

A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cctggcccgcgacggcccgcgccccttcccgctcggccgcctggtgccct
A0A2K6ASP2_BBC3-03      --------------------------------------------------

A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cggcagtgtcctgcggcctctgcgagcccggcctggctgccgcccccgcc
A0A2K6ASP2_BBC3-03      --------------------------------------------------

A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gcccccgccctgctgcccgctgcctacctctgcgcccccaccgccccacc
A0A2K6ASP2_BBC3-03      --------------------------------------------------

A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      cgccgtcaccgccaccctggggggcccccgctggcctgggggtccccgca
A0A2K6ASP2_BBC3-03      --------------------------------------------------

A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gccggccccgaggcccacgcccggacggtcctcagccctcgctcttgctg
A0A2K6ASP2_BBC3-03      --------------------------ggtcctcagccctcgctcttgctg

A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggc
A0A2K6ASP2_BBC3-03      gcggagcagcacctggagtcgcccgtgcccagcgccccgggggccctggc

A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagt
A0A2K6ASP2_BBC3-03      gggcggtcccacccaggcggccccgggagtccgcggggaggaggaacagt

A0A2K6ASP2_BBC3-02      --------------------------------------------------
A0A2K6ASP2_BBC3-01      gggcccgggagatcggggcccagctgcggcggatggcggacgacctcaac
A0A2K6ASP2_BBC3-03      gggcccgggagatcggggcccagctgcggcggatggcggacgacctcaac

A0A2K6ASP2_BBC3-02      -----------------gagacaagaggagcagcagcgacaccgcccctc
A0A2K6ASP2_BBC3-01      gcgcaatacgagcggcggagacaagaggagcagcagcgacaccgcccctc
A0A2K6ASP2_BBC3-03      gcgcaatacgagcggcggagacaagaggagcagcagcgacaccgcccctc

A0A2K6ASP2_BBC3-02      gccctggagggtcctgtacaatctcatcatgggactcctgcccttaccca
A0A2K6ASP2_BBC3-01      gccctggagggtcctgtacaatctcatcatgggactcctgcccttaccca
A0A2K6ASP2_BBC3-03      gccctggagggtcctgtacaatctcatcatgggactcctgcccttaccca

A0A2K6ASP2_BBC3-02      ggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcc
A0A2K6ASP2_BBC3-01      ggggccacagagcccccgaaatggagcccaattaggtgcctgcacccgcc
A0A2K6ASP2_BBC3-03      ggggccacagagcccccgaaatggagcccaattag---------------

A0A2K6ASP2_BBC3-02      cggtggacgtcagggactcggggggcaggcccctcccacctcctgacacc
A0A2K6ASP2_BBC3-01      cggtggacgtcagggactcggggggcaggcccctcccacctcctgacacc
A0A2K6ASP2_BBC3-03      --------------------------------------------------

A0A2K6ASP2_BBC3-02      ctggccagcgcgggggactttctctgcaccatgtag
A0A2K6ASP2_BBC3-01      ctggccagcgcgggggactttctctgcaccatgtag
A0A2K6ASP2_BBC3-03      ------------------------------------

© 1998-2020Legal notice