Dataset for CDS classical BH3-containing proteins of organism Loxodonta africana

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3T0P7_PMAIP1-01       ----------------------------------atgc------------
G3TP47_BAD-01          ggacccccagagaatccctcaccggcttccacacacgcccaaggcgtgag
G3SU55_BCL2L11-01      --------------------------atggcaaagcaaccttcagatgta
G3T2N1_BBC3-01         ----------------------------------atggccc------gcg
G3T7Z4_BMF-01          ----------------------------------atgccccgagcggggg
G3UH24_HRK-01          --------------------------atgtgtccgtgcccc---------

G3T0P7_PMAIP1-01       ---------------------cggggaagaaggc--------------ac
G3TP47_BAD-01          gatgtcgggagctgaacatc-cggagaagaagaagggacgcaggagatca
G3SU55_BCL2L11-01      agttctgagtgtg-------acagagaaggtggacagttacag-----cc
G3T2N1_BBC3-01         cacgccaggagggcagctcccccgagcccgtagagggtctggc-----cc
G3T7Z4_BMF-01          tattttggaaacaataccgcacggt----gttga--gtctcgt-----cc
G3UH24_HRK-01          ----------------ctgcaccgtggccgcggc--cccccgg-----cc
                                            * *                          

G3T0P7_PMAIP1-01       gcaagag-----cgcg-cagc-----------------------------
G3TP47_BAD-01          tcgggcgg----gctg-cagagtatgtt--ccagatcccagagtttgagc
G3SU55_BCL2L11-01      tgcggagaggcccccg-cagcctcctcagctcag--gcctggggcc----
G3T2N1_BBC3-01         gcgagag-----cccg-cgccccttcccactcggcagcctggtgccctcg
G3T7Z4_BMF-01          accagcg-----cccgccagcgcttgctgcc-----gccgccgtccgttc
G3UH24_HRK-01          gtgtgcg-----cctg-cagcgcaggtcgcctgg--gtctgcgctcgtcc
                           * *        * *                                

G3T0P7_PMAIP1-01       ------------------ccggccctgccggga----------------c
G3TP47_BAD-01          agagtgaccgggaagactccacccctgcagacaggggcctgggccccagc
G3SU55_BCL2L11-01      -------ccta-------cc-tctctgctcacggagcctcaaggtaa--t
G3T2N1_BBC3-01         gccgtgtcctg-------tggcctctgcgagcccggcctt---------c
G3T7Z4_BMF-01          gccgcg-cctg-------ccgccgctgcccgctgagctttttccctcctt
G3UH24_HRK-01          gccgcg-cagc-------tcaccgctgctcg------------------g
                                             * ****                      

G3T0P7_PMAIP1-01       cccggcaggtact-------------caacagcgc---------------
G3TP47_BAD-01          cccgaagggtactggccttcaggcccc---------------------ag
G3SU55_BCL2L11-01      cctga-cggtgaaggg-gacagctgcccccagggcagcccacagggcccg
G3T2N1_BBC3-01         ctcga--gttgcagggccacggctccttccggggc-------------ct
G3T7Z4_BMF-01          cccaatcgaatctgggcgccaagccccccgagtgctcgtca------cgc
G3UH24_HRK-01          ctcaa--ggcgcttggagacgagctgcaccagcgc---------------
                       *      *                                          

G3T0P7_PMAIP1-01       --------------------------------------------------
G3TP47_BAD-01          cgaccgccaccgtgtggccccaggcttcctgc------------------
G3SU55_BCL2L11-01      caggccccaccagccagccccggcccttttgctaccagatccccgctttt
G3T2N1_BBC3-01         cggacacagctgt---ttcccagcccctctcc----agtctgggtctctg
G3T7Z4_BMF-01          tggaccctggcgcggagccctggcgtcacgacccggagactgacactctt
G3UH24_HRK-01          ---accatgtggc--------ggcgtcgcgc-------------------

G3T0P7_PMAIP1-01       --------------------------------------------gatgtt
G3TP47_BAD-01          ----------------------gggactccagtcaccagcaggggcagcc
G3SU55_BCL2L11-01      catctttgtga----------gaagatcctccctgctgtctcgatcctcc
G3T2N1_BBC3-01         atctctcgggact-------------------------------gcagtt
G3T7Z4_BMF-01          tcctggagtcacccaggggagatggagccatctcagtgtgtggaggagct
G3UH24_HRK-01          ------------------------------------------gaggagcc

G3T0P7_PMAIP1-01       gtcgagtgtgctattcaactcaggagaa-------ttggagacaaaa---
G3TP47_BAD-01          gaccagcagcggccaccatggaggtgctgcggctgtggagacccggag--
G3SU55_BCL2L11-01      agcgggtatttctcttttgacacaga---------caggagcccagcac-
G3T2N1_BBC3-01         ggagagag---------------------------gtggggccgagtggg
G3T7Z4_BMF-01          ggaggatgatgtattccaaccagaggagggggagcctgggacccagcccg
G3UH24_HRK-01          ggagggcg---------------------------ccggcgcccggcgcg
                                                            *    *       

G3T0P7_PMAIP1-01       --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
G3SU55_BCL2L11-01      --------------------------------------------------
G3T2N1_BBC3-01         aggacagg------------------------------------------
G3T7Z4_BMF-01          ggggcttgctctctgctgacctgtttgcccagagccagctggactgcccc
G3UH24_HRK-01          --------------------------------------------------

G3T0P7_PMAIP1-01       ------------------------ttaatttccggcagaaacttctgaat
G3TP47_BAD-01          -------------------tcgccacagctcatacc-----ccgcagggt
G3SU55_BCL2L11-01      -----------------------------------------ccatgagtt
G3T2N1_BBC3-01         --------------gcccctcgtcctctctcaggtcctcagccctc----
G3T7Z4_BMF-01          ctcagccggcttcagctcttccctctcacccactgctgtggccctgggct
G3UH24_HRK-01          ---------------------ctccccacctac-----tggccctg----

G3T0P7_PMAIP1-01       gtgata--------------------------------------------
G3TP47_BAD-01          ctgatga-------------------------------------------
G3SU55_BCL2L11-01      gtgacaaatcaacacaaaccccaa--------------------------
G3T2N1_BBC3-01         --------------------------------------------------
G3T7Z4_BMF-01          tcgacacaccagccaggaggacaaggcaactcagactctcagcccagcct
G3UH24_HRK-01          --------------------------------------------------

G3T0P7_PMAIP1-01       --------------------------------------------------
G3TP47_BAD-01          ----------------------ggctgaagggctggaggaggatcccagc
G3SU55_BCL2L11-01      ----------------------gtcctccttgccaggccatcaaccatta
G3T2N1_BBC3-01         ----------------------actctcgccggcggagcagcacc-----
G3T7Z4_BMF-01          ccccaagccagggtgtcatgctgccttgtggggtgaccgaggaaccccag
G3UH24_HRK-01          ----------------------gctgtgcgcggcggcgcagg--------

G3T0P7_PMAIP1-01       -----------tgcaagctct-----------------------------
G3TP47_BAD-01          cccttt-----cggggtcgct--cgctttcag------------------
G3SU55_BCL2L11-01      cctcagtgcaatggcttccatgaggcagtct-------------------
G3T2N1_BBC3-01         -----------tggagtcgcc--ggtgccca-------------------
G3T7Z4_BMF-01          cgactcttttatggcaatgct--ggctaccggctccctctccctgccagt
G3UH24_HRK-01          -----------tggcggcgct--ggcggcctg----------------gc

G3T0P7_PMAIP1-01       -tctgctcaggc-----acctga---------------------------
G3TP47_BAD-01          cgccccccaacc------tctgggctgc----------------------
G3SU55_BCL2L11-01      -------caggc--tctacctgcagacctgcgcccgga------------
G3T2N1_BBC3-01         -----cgcaggc--ggccccgggggtccggggagaggatgagcaatgggc
G3T7Z4_BMF-01          ttccctgcaggcttgccacttggggagcagccccctgaagggcagtggca
G3UH24_HRK-01          tgctccgcaggc--ggaacttg----------------------------
                              **  *         *                            

G3T0P7_PMAIP1-01       --------------------------------------------------
G3TP47_BAD-01          -------acagagatatgg-----ccgtgagctccgcaggatgagtgatg
G3SU55_BCL2L11-01      ------------gatctggattgcgcgagagctacggcgcattggagacg
G3T2N1_BBC3-01         ccgagagatcggggcccagtttcggcggaag------------gcggacg
G3T7Z4_BMF-01          acatcgagcagaggtacagattgcccgaaagcttcagtgcattgcagacc
G3UH24_HRK-01          --------------------------------------------------

G3T0P7_PMAIP1-01       --------------------------------------------------
G3TP47_BAD-01          agttccagggctatttcaagggacttcctcgcccgaagagcgcgggcaca
G3SU55_BCL2L11-01      aattcaatgcctactaccca-------------aggagggcttttttgaa
G3T2N1_BBC3-01         acctctatgcgctgtacgag-------------cggtcggtgagacagga
G3T7Z4_BMF-01          acttccaccggcttcatatg-------------cag---------cggca
G3UH24_HRK-01          --------------------------------------------------

G3T0P7_PMAIP1-01       --------------------------------------------------
G3TP47_BAD-01          gcaacgcagatgcggcaaagccccagctggacacgcatcatccagg----
G3SU55_BCL2L11-01      taattaccaagcagccgaagaccaccctcaaatggttatcttacgt----
G3T2N1_BBC3-01         ggagcagca-----ccggcaccgtccctcgccctggagggtcctgtacaa
G3T7Z4_BMF-01          ccagcagaa-----ccgaaatcctgcgtggaggcagattctccaat----
G3UH24_HRK-01          --------------------------------------------------

G3T0P7_PMAIP1-01       --------------------------------------------------
G3TP47_BAD-01          ----------------cctggtgggatcggaatttggggagaggcagctc
G3SU55_BCL2L11-01      -----ctcttacgctacatcgtccgcctggtg--tggaga----------
G3T2N1_BBC3-01         tctcatcatgggactactgcccttaccaaggg--accatggcgcccccga
G3T7Z4_BMF-01          -----tcctgcaccaccttgctgtgaacgggg--aggagaacaggaatgg
G3UH24_HRK-01          --------------------------------------------------

G3T0P7_PMAIP1-01       ----------------
G3TP47_BAD-01          cgccccgtctcagtga
G3SU55_BCL2L11-01      ----------------
G3T2N1_BBC3-01         gatggagcccaattag
G3T7Z4_BMF-01          ggcaggtcctaggtga
G3UH24_HRK-01          ----------------

© 1998-2020Legal notice