Dataset for CDS BMF of organism Leptobrachium leishanense

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5R6G2_BMF-01      atgagttacaggatggagcaggagagcttcctaagttcagacgagctgga
A0A8C5R6G2_BMF-02      ------------atggagcaggagagcttcctaagttcagacgagctgga
                                   **************************************

A0A8C5R6G2_BMF-01      cgacgatgtgttctatccggatgactttgaattctcgcttccacccttga
A0A8C5R6G2_BMF-02      cgacgatgtgttctatccggatgactttgaattctcgcttccacccttga
                       **************************************************

A0A8C5R6G2_BMF-01      ctccaccttctccgttcatccagaagtatactagtttcttcgggaggttc
A0A8C5R6G2_BMF-02      ctccaccttctccgttcatccagaagtatactagtttcttcgggaggttc
                       **************************************************

A0A8C5R6G2_BMF-01      caccttttccctctgtctcactgctgtggtccaggatgtaggagcgcaga
A0A8C5R6G2_BMF-02      caccttttccctctgtctcactgctgtggtccaggatgtaggagcgcaga
                       **************************************************

A0A8C5R6G2_BMF-01      ctccgaagacaaggccacacagacacttgggtcaccatctgtaagcatga
A0A8C5R6G2_BMF-02      ctccgaagacaaggccacacagacacttgggtcaccatctgtaagcatga
                       **************************************************

A0A8C5R6G2_BMF-01      acgccatgttgccttgtggggtcacggaatccccccaaagacttttctat
A0A8C5R6G2_BMF-02      acgccatgttgccttgtggggtcacggaatccccccaaagacttttctat
                       **************************************************

A0A8C5R6G2_BMF-01      ggtaatgcaggatacatgttacagcatcccgcgcgctccccaagcttgct
A0A8C5R6G2_BMF-02      ggtaatgcaggatacatgttacagcatcccgcgcgctccccaagcttgct
                       **************************************************

A0A8C5R6G2_BMF-01      cagagaccatttgactcgcggaaggcaggagcagagtgctgagcgccgga
A0A8C5R6G2_BMF-02      cagagaccatttgactcgcggaaggcaggagcagagtgctgagcgccgga
                       **************************************************

A0A8C5R6G2_BMF-01      tcgcgcgcaaactacaatgtatcggagatcagtttcacaggcttcattta
A0A8C5R6G2_BMF-02      tcgcgcgcaaactacaatgtatcggagatcagtttcacaggcttcattta
                       **************************************************

A0A8C5R6G2_BMF-01      caaaagcttcaacagaacagaaatcaagtttggtctcagatcttcttctt
A0A8C5R6G2_BMF-02      caaaagcttcaacagaacagaaatcaagtttggtctcagatcttcttctt
                       **************************************************

A0A8C5R6G2_BMF-01      tttccgcaacctggtgatccaaaacgagagaaacaggggtgaggtgaact
A0A8C5R6G2_BMF-02      tttccgcaacctggtgatccaaaacgagagaaacaggggtgaggtgaact
                       **************************************************

A0A8C5R6G2_BMF-01      ggcgatga
A0A8C5R6G2_BMF-02      ggcgatga
                       ********

© 1998-2022Legal notice