Dataset for CDS BAD of organism Latimeria chalumnae

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H3ANP3_BAD-03      atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttg
H3ANP3_BAD-02      atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttg
H3ANP3_BAD-01      atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttg

H3ANP3_BAD-03      ccactgcagtctggaggaggaagaggcgagggatcagagccaagtgaaaaaacagcgggt
H3ANP3_BAD-02      ccactgcagtctggaggaggaagaggcgagggatcagagccaagtgaaaaaacagcgggt
H3ANP3_BAD-01      ccactgcagtctggaggaggaagaggcgagggatcagagccaagtgaaaaaacagcgggt

H3ANP3_BAD-03      ttaaagaaacacagccggacagcccccaatctgcagaacccgggacctcaccagagccac
H3ANP3_BAD-02      ttaaagaaacacagccggacagcccccaatctgcagaacccgggacctcaccagagccac
H3ANP3_BAD-01      ttaaagaaacacagccggacagcccccaatctgcagaacccgggacctcaccagagccac

H3ANP3_BAD-03      cccccttctcacacaggtgtatacggttgggtaaaacttaggaagcgaaataacatggag
H3ANP3_BAD-02      cccccttctcacacag---------------------------------ataacatggag
H3ANP3_BAD-01      cccccttctcacacag---------------------------------ataacatggag
                   ****************                                 ***********

H3ANP3_BAD-03      attctggggcgtccaagttccgagtcccagatctcagactcagaatcactggatgagctt
H3ANP3_BAD-02      attctggggcgtccaagttccgagtcccagatctcagactcagaatcactggatgagctt
H3ANP3_BAD-01      attctggggcgtccaagttccgagtcccagatctcagactcagaatcactggatgagctt

H3ANP3_BAD-03      ggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaaggaagtac
H3ANP3_BAD-02      ggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaaggaagtac
H3ANP3_BAD-01      ggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaaggaagtac

H3ANP3_BAD-03      gggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgagg
H3ANP3_BAD-02      gggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgagg
H3ANP3_BAD-01      gggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgagg

H3ANP3_BAD-03      ccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgata
H3ANP3_BAD-02      ccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgata
H3ANP3_BAD-01      ccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgata

H3ANP3_BAD-03      cgctctctaaaggggcgcgggcaacccagggacccgcctgggcaa---------------
H3ANP3_BAD-02      cgctctctaaaggggcgcgggcaacccagggacccgcctgggcaacagggagtgtcgatc
H3ANP3_BAD-01      cgctctctaaaggggcgcgggcaacccagggacccgcctgggcaacagggagtgtcgatc

H3ANP3_BAD-03      ---------------
H3ANP3_BAD-02      cgaggacctgactaa
H3ANP3_BAD-01      cgaggacctgactaa

© 1998-2020Legal notice