Dataset for CDS BAD of organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A287CT05_BAD-01      atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgc
A0A287CT05_BAD-02      atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgc

A0A287CT05_BAD-01      gaggaagtcagggaaggagggaccggggaggaaggcggtaggacccgcag
A0A287CT05_BAD-02      gaggaagtcagggaaggagggaccggggaggaaggcggtaggacccgcag

A0A287CT05_BAD-01      gtcggcggcgagggtggcacccggcctggacccagagcatgttccagatc
A0A287CT05_BAD-02      gtcggcggcgagggtggcacccggcctggacccagagcatgttccagatc

A0A287CT05_BAD-01      ccagagtttgagcccagtgagcaggaagactccagctccgcagaaggggg
A0A287CT05_BAD-02      ccagagtttgagcccagtgagcaggaagactccagctccgcagaaggggg

A0A287CT05_BAD-01      cctgggccccagccccgcaggggaccggccaggctgcggcttggctccag
A0A287CT05_BAD-02      cctgggccccagccccgcaggggaccggccaggctgcggcttggctccag

A0A287CT05_BAD-01      gcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagc
A0A287CT05_BAD-02      gcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagc

A0A287CT05_BAD-01      aaccatggaggcgctggggctacggagacccggagtcgccacagctcgta
A0A287CT05_BAD-02      aaccatggaggcgctggggctacggagacccggagtcgccacagctcgta

A0A287CT05_BAD-01      ccccgcagataccgatttggatgaagggatggaagaggagcccagcccct
A0A287CT05_BAD-02      ccccgcagataccgatttggatgaagggatggaagaggagcccagcccct

A0A287CT05_BAD-01      tccgcggccgctcgcgctcggcgccccccaatctctgggctgcacagcgc
A0A287CT05_BAD-02      tccgcggccgctcgcgctcggcgccccccaatctctgggctgcacagcgc

A0A287CT05_BAD-01      tacggccgcgagctccggaggatgagcgacgaattcgagggctcctttaa
A0A287CT05_BAD-02      tacggccgcgagctccggaggatgagcgacgaattcgagggctcctttaa

A0A287CT05_BAD-01      gg-gacttcctcgcccgaggagcgcaggcacagcgtcgcagatgcggcaa
A0A287CT05_BAD-02      ggtgacattttc--------------------------------------
                       ** *** *  **                                      

A0A287CT05_BAD-01      agctccagctggacgcgcttcatccagtcctggtgggatcggaacttggg
A0A287CT05_BAD-02      ----ccagtc------------cccattcctgaggg--------------
                           ****               *** *****  **              

A0A287CT05_BAD-01      gaggcgaggctccgccccctcccagtga
A0A287CT05_BAD-02      --------------------cctaa---
                                           ** *    

© 1998-2022Legal notice