Dataset for CDS BAD of organism Hucho hucho

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      atgttgtctccctctcctcctctccctttccctacctatccactctctct
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      -----atggctataatcaacactatcattcactgtggatgtcctttttct

A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      ctctgcctctcctcctgtctctttccctctctccacctctctctttccct
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      cttcagatatttaca-----------------------------------

A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      ccctctctacctctccactctctctctgccctctctccttcatctctctc
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------

A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      taccctctctctccacacctcttccccctctcactccacccctcttcacc
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------

A0A4W5JLL9_BAD-01      --------------------------------------------------
A0A4W5JLL9_BAD-02      tccatctcactcctttcttgtttcccctctctcactcactcccctgcctc
A0A4W5MZR2_BAD-01      --------------------------------------------------
A0A4W5R1T6_BAD-01      --------------------------------------------------

A0A4W5JLL9_BAD-01      -----------------------atggctcagatgt-ttactatatcag-
A0A4W5JLL9_BAD-02      cctcttcctccgtagatgtcagcatggctcagatgt-ttactatatcag-
A0A4W5MZR2_BAD-01      -----------------------atggaccacacacatgattgtgtggat
A0A4W5R1T6_BAD-01      -----------------------atgaaccacacacatgattgtgtggat
                                              ***   ** *    * * * * *    

A0A4W5JLL9_BAD-01      -------------------------acagcgagtcagagccctcagagga
A0A4W5JLL9_BAD-02      -------------------------acagcgagtcagagccctcagagga
A0A4W5MZR2_BAD-01      g------------------------aatgtgagtctgatcactc------
A0A4W5R1T6_BAD-01      gacaacccagaaaccatgaatgaaaaagatgagtctgaccactc------
                                                *    ***** ** * ***      

A0A4W5JLL9_BAD-01      ggtaggagaaaccgaaaaggaccaattggctgccggaaaggggatgactg
A0A4W5JLL9_BAD-02      ggtaggagaaaccgaaaaggaccaattggctgccggaaaggggatgactg
A0A4W5MZR2_BAD-01      ------aggaaccacacacaactca--------------------gaatt
A0A4W5R1T6_BAD-01      ------aggaaccacacactaccca--------------------gaatt
                             ** ****  * *  **  *                    ** * 

A0A4W5JLL9_BAD-01      gcggcccaataggccacgccctcactgtgcctgagatgagactggcagga
A0A4W5JLL9_BAD-02      gcggcccaataggccacgccctcactgtgcctgagatgagactggcagga
A0A4W5MZR2_BAD-01      tcagctcca-------tgtctcaactacaatgagcaccagaccaagacca
A0A4W5R1T6_BAD-01      tcagctccata----ctgtctccactacgacgagcaccagaccacgacca
                        * ** * *        * *   ***         *  ****    *  *

A0A4W5JLL9_BAD-01      gagggtcggttgaggatgaactcagagtcccagg------cccag-----
A0A4W5JLL9_BAD-02      gagggtcggttgaggatgaactcagagtcccagg------cccag-----
A0A4W5MZR2_BAD-01      ggtgagcgagtccggctctactcagagtcccaggtgtgctcccaggttgg
A0A4W5R1T6_BAD-01      ggtgggcgagtccggctctactccgagtcccaggtgttctcccacgttgg
                       *  *  **  *  ** *  **** **********      ****      

A0A4W5JLL9_BAD-01      ----------------gagctccagggt----------------aggggg
A0A4W5JLL9_BAD-02      ----------------gagctccagggt----------------aggggg
A0A4W5MZR2_BAD-01      caaaagggaaaacacagagtttcaggatgtgatgactcctactgaggagg
A0A4W5R1T6_BAD-01      cagaagggacgacacagagtttcaggatgcaatgactcctactgaggagg
                                       *** * **** *                *** **

A0A4W5JLL9_BAD-01      ccaggggtggaaggcatgcccacagacggagcatctttccgggttcgctc
A0A4W5JLL9_BAD-02      ccaggggtggaaggcatgcccacagacggagcatctttccgggttcgctc
A0A4W5MZR2_BAD-01      gcggaggt----------------gatggggcttcattccgaggccgatc
A0A4W5R1T6_BAD-01      gcgggggc----------------gatggggctcctttccgaagccgatc
                        * * **                 ** ** **  * *****    ** **

A0A4W5JLL9_BAD-01      ccagtcggccccccctgccctctgggcggccaagaaatacgggcggcagc
A0A4W5JLL9_BAD-02      ccagtcggccccccctgccctctgggcggccaagaaatacgggcggcagc
A0A4W5MZR2_BAD-01      acagtctgctcctcctgcactgtgggctgcaaagaaatatggctgccagc
A0A4W5R1T6_BAD-01      acagtctgctcctcctgcactgtgggctgcaaagaaatatggccgccagc
                        ***** ** ** ***** ** ***** ** ******** **  * ****

A0A4W5JLL9_BAD-01      tccgacgcatgagtgacgagtttgatacgtggctggataaaggggagatg
A0A4W5JLL9_BAD-02      tccgacgcatgagtgacgagtttgatacgtggctggataaaggggagatg
A0A4W5MZR2_BAD-01      tgaggaggatgagtgatgaatttgacacctggcttgacaaaggggagcct
A0A4W5R1T6_BAD-01      tgaggaggatgagtgatgaatttgacacctggctcgacaaaggggagccc
                       *  *  * ******** ** ***** ** ***** ** *********   

A0A4W5JLL9_BAD-01      aggcgggtgaagagtgcgggagcagccaaacagatgaccaagtccccc--
A0A4W5JLL9_BAD-02      aggcgggtgaagagtgcgggagcagccaaacagatgaccaagtccccc--
A0A4W5MZR2_BAD-01      aagagagggattagcccaggaggaggcaagcaga-----aagtctcccga
A0A4W5R1T6_BAD-01      aagagagggattagcccaggagggatcaagcagg-----aggtctcccga
                       * * * * **  **  * ****    *** ***      * *** ***  

A0A4W5JLL9_BAD-01      agctggtgggcctacctgttcagtcataaggagacag-agacagaacata
A0A4W5JLL9_BAD-02      agctggtgggcctacctgttcagtcataaggagacag-agacagaacata
A0A4W5MZR2_BAD-01      ggatggttctctttcctctggagtccaaaggaggcggaaggcagg-----
A0A4W5R1T6_BAD-01      ggatggttctctttcctctggagtccaaaggagtcggaaggcagg-----
                        * ****   * * *** *  ****  ****** * * ** ***      

A0A4W5JLL9_BAD-01      cccctaccatcccaccacgatcatctgagtag
A0A4W5JLL9_BAD-02      cccctaccatcccaccacgatcatctgagtag
A0A4W5MZR2_BAD-01      --------------------------gagtga
A0A4W5R1T6_BAD-01      --------------------------gagtga

© 1998-2021Legal notice