Dataset for CDS classical BH3-containing proteins of organism Heterocephalus glaber

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G5BM80_BIK-01          atg-----------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
G5B6Q3_BAD-01          atgcggactccagagaacccctcacccgctcctacaaatgccgaaggatt
G5BQZ0_BCL2L11-04      atg-----------------------------------------------
G5BQZ0_BCL2L11-02      atg-----------------------------------------------
G5BQZ0_BCL2L11-01      atg-----------------------------------------------
G5BQZ0_BCL2L11-03      atg-----------------------------------------------
                                                                         

G5BM80_BIK-01          ---------------------tcggaagcaagacccgtcaccagg-gacc
G5B6Q3_BAD-02          ----------------------------------------------atgt
G5B6Q3_BAD-01          aaggaagttggagctggggatccggagacttgagtcagcccagagcatgt
G5BQZ0_BCL2L11-04      ---------------------------------------gccaagcaacc
G5BQZ0_BCL2L11-02      ---------------------------------------gccaagcaacc
G5BQZ0_BCL2L11-01      ---------------------------------------gccaagcaacc
G5BQZ0_BCL2L11-03      ---------------------------------------gccaagcaacc
                                                                         

G5BM80_BIK-01          tgctcatggagaccctgctgtatgagccgctccctgggcctctgttggcc
G5B6Q3_BAD-02          tccagatccca-----ga-gtttgagc-----------------------
G5B6Q3_BAD-01          tccagatccca-----ga-gtttgagc-----------------------
G5BQZ0_BCL2L11-04      ttccgatgtaagttgtga-gtgtga-------------------------
G5BQZ0_BCL2L11-02      ttccgatgtaagttgtga-gtgtga-------------------------
G5BQZ0_BCL2L11-01      ttccgatgtaagttgtga-gtgtga-------------------------
G5BQZ0_BCL2L11-03      ttccgatgtaagttgtga-gtgtga-------------------------
                       * *  **         *  ** ***                         

G5BM80_BIK-01          acaggggccttggctgtgatgcatcccttcaggggagagg-------atc
G5B6Q3_BAD-02          -caagtgagcaggaag-actccagctcc---gaagagag-----------
G5B6Q3_BAD-01          -caagtgagcaggaag-actccagctcc---gaagagag-----------
G5BQZ0_BCL2L11-04      -cagagaaggtggaca-attgcaac-ct---gctgagaggccgccccagc
G5BQZ0_BCL2L11-02      -cagagaaggtggaca-attgcaac-ct---gctgagaggccgccccagc
G5BQZ0_BCL2L11-01      -cagagaaggtggaca-attgcaac-ct---gctgagaggccgccccagc
G5BQZ0_BCL2L11-03      -cagagaaggtggaca-attgcaac-ct---gctgagaggccgccccagc
                        **        **      * ** * *    *  *****           

G5BM80_BIK-01          tcagtcccccaggggacactgacctcgtgggctgcctggaaggcagca--
G5B6Q3_BAD-02          ---ggccc----tgggccccacccccacaggggaccggctaggcccca--
G5B6Q3_BAD-01          ---ggccc----tgggccccacccccacaggggaccggctaggcccca--
G5BQZ0_BCL2L11-04      tcaggcct----ggggcccctacctccc----tacagacggagcccca--
G5BQZ0_BCL2L11-02      tcaggcct----ggggcccctacctccc----tacagacggagccccaag
G5BQZ0_BCL2L11-01      tcaggcct----ggggcccctacctccc----tacagacggagccccaag
G5BQZ0_BCL2L11-03      tcaggcct----ggggcccctacctccc----tacagacggagcccca--
                          * **      ** * *   ** *        *       **  **  

G5BM80_BIK-01          --------------------------------------------------
G5B6Q3_BAD-02          -----------------------------------------------gtt
G5B6Q3_BAD-01          -----------------------------------------------gtt
G5BQZ0_BCL2L11-04      --------------------------------------------------
G5BQZ0_BCL2L11-02      gtaatcccgaaggcagtcccgaagtcgaaggggaccgctgcccccacggc
G5BQZ0_BCL2L11-01      gtaatcccgaaggcagtcccgaagtcgaaggggaccgctgcccccacggc
G5BQZ0_BCL2L11-03      --------------------------------------------------
                                                                         

G5BM80_BIK-01          -gcctgatggccctgcgg------ctggcctgcattggtgatg-------
G5B6Q3_BAD-02          caccaggaggcttcctgggagacatcagtcaccagcag------------
G5B6Q3_BAD-01          caccaggaggcttcctgggagacatcagtcaccagcag------------
G5BQZ0_BCL2L11-04      --------------------------------------------------
G5BQZ0_BCL2L11-02      agcccgcagggcccgctggccccaccggccagccctggcccttttgctac
G5BQZ0_BCL2L11-01      agcccgcagggcccgctggccccaccggccagccctggcccttttgctac
G5BQZ0_BCL2L11-03      --------------------------------------------------
                                                                         

G5BM80_BIK-01          --------------------------------------------------
G5B6Q3_BAD-02          --------------------------------------------------
G5B6Q3_BAD-01          --------------------------------------------------
G5BQZ0_BCL2L11-04      --------------------------------------------------
G5BQZ0_BCL2L11-02      cagatccccgcttttcatctttgtgagaagatcttccctgctgtctcgat
G5BQZ0_BCL2L11-01      cagatccccgcttttcatctttgtgagaagatcttccctgctgtctcgat
G5BQZ0_BCL2L11-03      --------------------------------------------------
                                                                         

G5BM80_BIK-01          ----------------------------agatggacctgcgtctccgggc
G5B6Q3_BAD-02          ----------------------------aggcagctgatcagcagcagac
G5B6Q3_BAD-01          ----------------------------aggcagctgatcagcagcagac
G5BQZ0_BCL2L11-04      ----------------------------agacaggagcccggca------
G5BQZ0_BCL2L11-02      cctccagtgggtatttctcttttgacacagacaggagcccggca------
G5BQZ0_BCL2L11-01      cctccagtgggtatttctcttttgacacagacaggagcccggca------
G5BQZ0_BCL2L11-03      ----------------------------agacaggagcccggca------
                                                   **   *     *  *       

G5BM80_BIK-01          cccccgcctggcccagttgcccgggagggccgtgcacagcctggcca---
G5B6Q3_BAD-02          accatg-gaggcactggggctacggagacccggagtc------gcca---
G5B6Q3_BAD-01          accatg-gaggcactggggctacggagacccggagtc------gcca---
G5BQZ0_BCL2L11-04      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
G5BQZ0_BCL2L11-02      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
G5BQZ0_BCL2L11-01      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
G5BQZ0_BCL2L11-03      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
                        **  *    *        *     *   **     *      ****   

G5BM80_BIK-01          ---tcacctacagccaaatggggctctggggtgtgctcagaagcctgact
G5B6Q3_BAD-02          ---cagctcataccccacgggga---tggaggaggaggcggggatgaagg
G5B6Q3_BAD-01          ---cagctcataccccacgggga---tggaggaggaggcggggatgaagg
G5BQZ0_BCL2L11-04      cttcaaccattatctcagtgcaa---tgg---------------------
G5BQZ0_BCL2L11-02      cttcaaccattatctcagtgcaa---tggcttccatgcggcagtctcagg
G5BQZ0_BCL2L11-01      cttcaaccattatctcagtgcaa---tggcttccatgcggcagtctcagg
G5BQZ0_BCL2L11-03      cttcaaccattatctcagtgcaa---tggcttccatgcggcagtctcagg
                             *    * *  *  *      ***                     

G5BM80_BIK-01          cctggtctcaccagcctcagggacatgtggccctggggacacctagcccc
G5B6Q3_BAD-02          aggagcccagtccattccggggccgctcacgctcagcgcctccca-----
G5B6Q3_BAD-01          aggagcccagtccattccggggccgctcacgctcagcgcctccca-----
G5BQZ0_BCL2L11-04      -----------------------ggtac-------------ccag-----
G5BQZ0_BCL2L11-02      ctgaacc--------tccggatatgcgc-------------ccag-----
G5BQZ0_BCL2L11-01      ctgaacc--------tccggatatgcgc-------------ccag-----
G5BQZ0_BCL2L11-03      ctgaacc--------tccggatatgcgc-------------ccag-----
                                                                **       

G5BM80_BIK-01          ccacgcctgggtgtcccctggctgggcctgcaggcagctgctgc----ct
G5B6Q3_BAD-02          --atctctgggctgcacagcgctatg---gcagagagctccggaggatga
G5B6Q3_BAD-01          --atctctgggctgcacagcgctatg---gcagagagctccggaggatga
G5BQZ0_BCL2L11-04      --aga----gcttgcacag-------------------------------
G5BQZ0_BCL2L11-02      --agatatggattgcgcag---------------gagttgcgacgcatcg
G5BQZ0_BCL2L11-01      --agatatggattgcgcag---------------gagttgcgacgcatcg
G5BQZ0_BCL2L11-03      --agatatggattgcgcag---------------gagttgcgacgcatcg
                         *      *    * *                                 

G5BM80_BIK-01          gtggtgctgttggtgctgctgctcgggatcctgcgcctcctgctgcaggg
G5B6Q3_BAD-02          gcgatgagttcgtggactccttcaagggtcttcctcgcccgaaaagcgcg
G5B6Q3_BAD-01          gcgatgagttcgtggactccttcaagggtcttcctcgcccgaaaagcgcg
G5BQZ0_BCL2L11-04      --------------------------------------------------
G5BQZ0_BCL2L11-02      gagatgaatttaatgcct---------------cttacccaaggagggt-
G5BQZ0_BCL2L11-01      gagatgaatttaatgcct---------------cttacccaaggagggt-
G5BQZ0_BCL2L11-03      gagatgaatttaatgcct---------------cttacccaaggagggt-
                                                                         

G5BM80_BIK-01          aggcccggcaggcaggcagggctggtccctgtcccctctgccaccactgc
G5B6Q3_BAD-02          ggcacagcgacgaagctgtggcagagctccagttggacacgcgccatcca
G5B6Q3_BAD-01          ggcacagcgacgaagctgtggcagagctccagttggacacgcgccatcca
G5BQZ0_BCL2L11-04      --------------------------------------------------
G5BQZ0_BCL2L11-02      -------------atttttgaataattaccaaccggccgaggaccacccc
G5BQZ0_BCL2L11-01      -------------atttttgaataattaccaaccggccgaggaccacccc
G5BQZ0_BCL2L11-03      -------------atttttgaataattaccaaccggccgaggaccacccc
                                                                         

G5BM80_BIK-01          cccccgg-------ggggccaccgcctggccagctttgttcttttt----
G5B6Q3_BAD-02          gtcctggtgggatcggaacttgggaagaggaggctccgccccctct----
G5B6Q3_BAD-01          gtcctggtgggatcggaacttgggaagaggaggctccgccccctct----
G5BQZ0_BCL2L11-04      --------------------------------------------------
G5BQZ0_BCL2L11-02      caaatggttatcttgcgactattacgctacattgtccgcctcgtgtggag
G5BQZ0_BCL2L11-01      caaatggttatcttgcgactattacgctacattgtccgcctcgtgtggag
G5BQZ0_BCL2L11-03      caaatggttatcttgcgactattacgctacattgtccgcctcgtgtggag
                                                                         

G5BM80_BIK-01          --------aa
G5B6Q3_BAD-02          ----cagtga
G5B6Q3_BAD-01          ----cagtga
G5BQZ0_BCL2L11-04      ------ctgt
G5BQZ0_BCL2L11-02      aatgcactga
G5BQZ0_BCL2L11-01      aatgcactga
G5BQZ0_BCL2L11-03      aatgcactga
                                 

© 1998-2020Legal notice