Dataset for CDS BAD of organism Gouania willdenowi

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5I9J2_BAD-01      ---------------------atggcagccaacttctctatttcagacag
A0A8C5I9J2_BAD-02      atgatgccattttatgtcaaaatggcagccaacttctctatttcagacag
                                            *****************************

A0A8C5I9J2_BAD-01      cgagtcagatccatcagaggaggtagaggaagaagataacccaacacgaa
A0A8C5I9J2_BAD-02      cgagtcagatccatcagaggaggtagaggaagaagataacccaacacgaa
                       **************************************************

A0A8C5I9J2_BAD-01      agcatcggattcctttacacctcagcctcaacctgcctgacttcggacta
A0A8C5I9J2_BAD-02      agcatcggattcctttacacctcagcctcaacctgcctgacttcggacta
                       **************************************************

A0A8C5I9J2_BAD-01      acaggacctggtcgtattagggtcaactccgagtccgtgtcctccactgt
A0A8C5I9J2_BAD-02      acaggacctggtcgtattagggtcaactccgagtccgtgtcctccactgt
                       **************************************************

A0A8C5I9J2_BAD-01      ctccagagatgaggaagaggtgggtacgcctaccgacggtgctccattca
A0A8C5I9J2_BAD-02      ctccagagatgaggaagaggtgggtacgcctaccgacggtgctccattca
                       **************************************************

A0A8C5I9J2_BAD-01      gagggcgctcgaagtcagctcccccttccctgtgggcagcgaagaaatac
A0A8C5I9J2_BAD-02      gagggcgctcgaagtcagctcccccttccctgtgggcagcgaagaaatac
                       **************************************************

A0A8C5I9J2_BAD-01      ggccagcggctaagaaggatgagtgatgaattcgacagtctgctggataa
A0A8C5I9J2_BAD-02      ggccagcggctaagaaggatgagtgatgaattcgacagtctgctggataa
                       **************************************************

A0A8C5I9J2_BAD-01      aggggaaatgaggaaggtgaggagtgcagggagcacgaagcagatgcacc
A0A8C5I9J2_BAD-02      aggggaaatgaggaaggtgaggagtgcagggagcacgaagcagatgcacc
                       **************************************************

A0A8C5I9J2_BAD-01      actctaaaagctggtggagctacctctttagtcaccaggaaatggaagga
A0A8C5I9J2_BAD-02      actctaaaagctggtggagctacctctttagtcaccaggaaatggaagga
                       **************************************************

A0A8C5I9J2_BAD-01      gagaacaaccaccacgacggccacacccccgagcgcacagaatag
A0A8C5I9J2_BAD-02      gagaacaaccaccacgacggccacacccccgagcgcacagaatag
                       *********************************************

© 1998-2022Legal notice