Dataset for CDS BCL2L11 of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8XIA2_BCL2L11      --------------------------------------------------
A0A3P8XIA2_BCL2L11      atgtttgattcgtccagaccacaaaatcggtccaatggcacgaccaccct

A0A3P8XIA2_BCL2L11      -------------------agagagtc-----------------------
A0A3P8XIA2_BCL2L11      aattgggagagggaaaatcggagagtcgcatccctgtggcggagcaacct

A0A3P8XIA2_BCL2L11      ----------------------------ttcctgcgaagggaaccagcag
A0A3P8XIA2_BCL2L11      cgagttccaaactgtcagattacccccagtcctgcgaagggaaccagcag

A0A3P8XIA2_BCL2L11      tcacggggaggaataatgatgccgacgaatagtctgcttggtttccagtc
A0A3P8XIA2_BCL2L11      tcacggggaggaataatgatgccgacgaatagtctgcttggtttccagtc

A0A3P8XIA2_BCL2L11      gaggtcgcctcttttcagaacaacatccacgtcctccagtggatattttt
A0A3P8XIA2_BCL2L11      gaggtcgcctcttttcagaacaacatccacgtcctccagtggatattttt

A0A3P8XIA2_BCL2L11      cgttcgactgcgactctattccaagctcgccactactaagaaataacaag
A0A3P8XIA2_BCL2L11      cgttcgactgcgactctattccaagctcgccactactaagaaataacaag

A0A3P8XIA2_BCL2L11      tcgacacagactccgagcccatctagtcaagttattactcacgcaatgag
A0A3P8XIA2_BCL2L11      tcgacacagactccgagcccatctagtcaagttattactcacgcaatgag

A0A3P8XIA2_BCL2L11      gc------------------------------------------------
A0A3P8XIA2_BCL2L11      gcgcttgtctaagccacaagacacctggcgaggttatgaagcgtggccca

A0A3P8XIA2_BCL2L11      ---------------------------------------cgggggacatg
A0A3P8XIA2_BCL2L11      ccccccaccacccctatagaccacggccaccaccaatagcgggggacatg

A0A3P8XIA2_BCL2L11      cggccggaaatactgatcggtcaggagcttcagcgcattggagatgagtt
A0A3P8XIA2_BCL2L11      cggccggaaatactgatcggtcaggagcttcagcgcattggagatgagtt

A0A3P8XIA2_BCL2L11      taacaacctgttcatacatggggtgagtggttgcagtaaaatgcctgtgt
A0A3P8XIA2_BCL2L11      taacaacctgttcatacat-gggcgtcttggggcaa-gaaatggtcaggt
                        ******************* *** *  * *  ***   *****     **

A0A3P8XIA2_BCL2L11      tgcat-----caccttatttacaaaccatatcaaggaccg-------cac
A0A3P8XIA2_BCL2L11      tgcccaagcaaaccttcctcagatgc---accaagaacctgcctttctac
                        ***        *****  * * *  *   * **** ***         **

A0A3P8XIA2_BCL2L11      tg-------------------------tatta-----aattgagctga--
A0A3P8XIA2_BCL2L11      tgtggatgggcctcctgattggtcgactattacagatcatttggcggaga
                        **                         *****      ***  ** **  

A0A3P8XIA2_BCL2L11      ------
A0A3P8XIA2_BCL2L11      agataa

© 1998-2020Legal notice