Dataset for CDS BMF of organism Erpetoichthys calabaricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4SHZ6_BMF-02      atggtagctgaagtcgaagtgactctgaatatcgacccttttgtcttgtt
A0A8C4SHZ6_BMF-01      --------------------------------------------------
                                                                         

A0A8C4SHZ6_BMF-02      tgacagattaccattgagatcacgtatacgtatggatccagaggaggaca
A0A8C4SHZ6_BMF-01      -------------------------------atggatccagaggaggaca
                                                      *******************

A0A8C4SHZ6_BMF-02      ttgaggatgatgtgtttcatccgccagaactggacaggtacccacacaca
A0A8C4SHZ6_BMF-01      ttgaggatgatgtgtttcatccgccagaactggacaggtacccacacaca
                       **************************************************

A0A8C4SHZ6_BMF-02      ataagtgggacgttccgacactgcagcacttccccacgggcaaacccttt
A0A8C4SHZ6_BMF-01      ataagtgggacgttccgacactgcagcacttccccacgggcaaacccttt
                       **************************************************

A0A8C4SHZ6_BMF-02      ttttatttgccagcgctttcgagaagtgaaatacgtggaccagagcacac
A0A8C4SHZ6_BMF-01      ttttatttgccagcgctttcgagaagtgaaatacgtggaccagagcacac
                       **************************************************

A0A8C4SHZ6_BMF-02      agacgacgagtaatcacgtgccgagctacagcagcatgctgccttacggg
A0A8C4SHZ6_BMF-01      agacgacgagtaatcacgtgccgagctacagcagcatgctgccttacggg
                       **************************************************

A0A8C4SHZ6_BMF-02      gttcaagaggagccttcatatctcttttacggtacagcagcccatcgctt
A0A8C4SHZ6_BMF-01      gttcaagaggagccttcatatctcttttacggtacagcagcccatcgctt
                       **************************************************

A0A8C4SHZ6_BMF-02      gcacttcccagcacattttgaggtggatcgagatggggacacggaagaag
A0A8C4SHZ6_BMF-01      gcacttcccagcacattttgaggtggatcgagatggggacacggaagaag
                       **************************************************

A0A8C4SHZ6_BMF-02      gaatggcagaagaagaacaggagcctggtctgagcgcagaagcacagatc
A0A8C4SHZ6_BMF-01      gaatggcagaagaagaacaggagcctggtctgagcgcagaagcacagatc
                       **************************************************

A0A8C4SHZ6_BMF-02      ggccaaaagcttcaaagaattggagatcagttccacagagattacacaca
A0A8C4SHZ6_BMF-01      ggccaaaagcttcaaagaattggagatcagttccacagagattacacaca
                       **************************************************

A0A8C4SHZ6_BMF-02      aatgctacagcagaaccaaaggaacccccagccattgtggtggaggatgg
A0A8C4SHZ6_BMF-01      aatgctacagcagaaccaaaggaacccccagccattgtggtggaggatgg
                       **************************************************

A0A8C4SHZ6_BMF-02      ccgtcaccttgttggcctttcttttcgatcgagatgcaggtccgaatcga
A0A8C4SHZ6_BMF-01      ccgtcaccttgttggcctttcttttcgatcgagatgcaggtccgaatcga
                       **************************************************

A0A8C4SHZ6_BMF-02      atggacgcaagatga
A0A8C4SHZ6_BMF-01      atggacgcaagatga
                       ***************

© 1998-2022Legal notice