Dataset for CDS BCL2L11 of organism Erpetoichthys calabaricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4REW7_BCL2L11      atggcacgaccaccctcagatctaaattctgaaagtggcgcaggggatgg
A0A8C4REW7_BCL2L11      atggcacgaccaccctcagatctaaattctgaaagtggcgcaggggatgg
                        **************************************************

A0A8C4REW7_BCL2L11      tggaccattgcagcccacccaagaagcaggtcgtcctctgagtagaccag
A0A8C4REW7_BCL2L11      tggaccattgcagcccacccaagaagcaggtcgtcctctgagtagaccag
                        **************************************************

A0A8C4REW7_BCL2L11      gtccaaggacccattctgaaggtgaccaaagtggtgaagtgagccaaccc
A0A8C4REW7_BCL2L11      gtccaaggacccattctgaaggtgaccaaagtggtgaagtgagccaaccc
                        **************************************************

A0A8C4REW7_BCL2L11      gcacccaacagcctgcagggaggacttgctatgccccccagtccccatcc
A0A8C4REW7_BCL2L11      gcacccaacagcctgcagggaggacttgctatgccccccagtccccatcc
                        **************************************************

A0A8C4REW7_BCL2L11      ttatgcctccaggtttccattgtttagttatttctcaaggtcatccagtg
A0A8C4REW7_BCL2L11      ttatgcctccaggtttccattgtttagttatttctcaaggtcatccagtg
                        **************************************************

A0A8C4REW7_BCL2L11      gatactattcttttgaatctggttctgtttccagcttgccatcaatgact
A0A8C4REW7_BCL2L11      gatactattcttttgaatctggttctgtttccagcttgccatcaatgact
                        **************************************************

A0A8C4REW7_BCL2L11      gacaaattcacacagacgccaagtctttctagtcaagcaataagacatgc
A0A8C4REW7_BCL2L11      gacaaattcacacagacgccaagtctttctagtcaagcaataagacatgc
                        **************************************************

A0A8C4REW7_BCL2L11      ccagcagtggttagctcaagaatacgaacattatcaaggccatgacatgc
A0A8C4REW7_BCL2L11      ccagcagtggttagctcaagaatacgaacattatcaaggccatgacatgc
                        **************************************************

A0A8C4REW7_BCL2L11      cacaggcttcatctggtcctaccagagctagacgctcctcaatgccagaa
A0A8C4REW7_BCL2L11      cacaggcttcatctggtcctaccagagctagacgctcctcaatgccagaa
                        **************************************************

A0A8C4REW7_BCL2L11      gagatgcgaccagaagaaatggtggctcaagaactgcgacgaattggaga
A0A8C4REW7_BCL2L11      gagatgcgaccagaagaaatggtggctcaagaactgcgacgaattggaga
                        **************************************************

A0A8C4REW7_BCL2L11      cgatttcaacaatctatattttcaaagg------------------ggca
A0A8C4REW7_BCL2L11      cgatttcaacaatctatattttcaaagggtagccagggcctatccaggca
                        ****************************                  ****

A0A8C4REW7_BCL2L11      tcggtggcaggaacaatggagcagaagccagtcgtcttc--ggtgggtta
A0A8C4REW7_BCL2L11      gcgtttggagaa------gggcaggaaccagctgtggacagggttggtta
                         ** * * ** *      * **** * ****  **   *  *** *****

A0A8C4REW7_BCL2L11      ttgtgtttgtgtggcgactttttgatattttaacaagatggcgttaa
A0A8C4REW7_BCL2L11      gt-tcattgcagggca-----cagatgctt-----------------
                         * *  ***   ***        ***  **                 

© 1998-2022Legal notice