Dataset for CDS BMF of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2HR24_BMF-01      atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagcc
A0A3Q2HR24_BMF-02      atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagcc

A0A3Q2HR24_BMF-01      agaggatggggagccggggacccagcccaggagcttgctctctgctgacc
A0A3Q2HR24_BMF-02      agaggatggggagccggggacccagcccaggagcttgctctctgctgacc

A0A3Q2HR24_BMF-01      tgtttgccccgagccagctggactgccccctcagccatctgcggctcttc
A0A3Q2HR24_BMF-02      tgtttgccccgagccagctggactgccccctcagccatctgcggctcttc

A0A3Q2HR24_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A3Q2HR24_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga

A0A3Q2HR24_BMF-01      caaggccacccagaccctcagtccagcctccccaagccagggtgtcatgc
A0A3Q2HR24_BMF-02      caaggccacccagaccctcagtccagcctccccaagccagggtgtcatgc

A0A3Q2HR24_BMF-01      tgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgct
A0A3Q2HR24_BMF-02      tgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgct

A0A3Q2HR24_BMF-01      ggctaccggctccctctccctgccagtttccctgcaggcttgccccttgg
A0A3Q2HR24_BMF-02      ggctaccggctccctctccctgccagtttccctgcaggcttgccccttgg

A0A3Q2HR24_BMF-01      tgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
A0A3Q2HR24_BMF-02      tgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg

A0A3Q2HR24_BMF-01      cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcag
A0A3Q2HR24_BMF-02      cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcag

A0A3Q2HR24_BMF-01      caacaccagcagaaccgaaatcgcgtgtggtggcagaccctgctctttct
A0A3Q2HR24_BMF-02      caacaccagcagaaccgaaatcgcgtgtggtggcagaccctgctctttct

A0A3Q2HR24_BMF-01      ccacaacctcgctttgaacggagacgagaacaggaacggggcaggtccca
A0A3Q2HR24_BMF-02      ccacaacctcgctttgaacggagacgagaacaggaacggggcaggtccca

A0A3Q2HR24_BMF-01      gcttccagccaggccaggagggtgtgctctggaagtcagcaggattgcag
A0A3Q2HR24_BMF-02      g-gtgtggtaaaaatgtgaggggacccgttagggaattggagacttctga
                       *  *   *  *      *****    *  * *      * **  **    

A0A3Q2HR24_BMF-01      ct---------gcctctgtccgaacttcttcccttctctccctgctgtgg
A0A3Q2HR24_BMF-02      cttgtttctcagctgccatcctgagtta--cccccagctcccggcttttg
                       **         **  *  ***  * **   ***    ***** *** * *

A0A3Q2HR24_BMF-01      cactaatggagagaatttaaagcagccagtctggctgctctga
A0A3Q2HR24_BMF-02      tc---------aggacttcgtgc------tctcttggagttga
                                  ** * **   **      ***    *   ***

© 1998-2021Legal notice