Dataset for CDS BIK of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2LHE3_BIK-02      atgagaaagcggcggcgtcacgcagctgctaagcggcagacctgggattc
A0A3Q2LHE3_BIK-01      --------------------------------------------------

A0A3Q2LHE3_BIK-02      gaactcaggccctctggtttcagagccgcgttcttcatcatcgtattctg
A0A3Q2LHE3_BIK-01      --------------------------------------------------

A0A3Q2LHE3_BIK-02      tacctaaggctgtttggtccagtgtgggagaagaaatgtctcaagtagga
A0A3Q2LHE3_BIK-01      -----------------------------------atgtctcaagtagga

A0A3Q2LHE3_BIK-02      cccgtctccagggacctctttctggacgccttcctgcacgagcgcagccc
A0A3Q2LHE3_BIK-01      cccgtctccagggacctctttctggacgccttcctgcacgagcgcagccc

A0A3Q2LHE3_BIK-02      ggaagccctggaggttcctggcatgaccgagctcacagagtcctcccccg
A0A3Q2LHE3_BIK-01      ggaagccctggaggttcctggcatgaccgagctcacagagtcctcccccg

A0A3Q2LHE3_BIK-02      acagtgacaaccgtgactctgtggccatgcggctggccttcatcggggac
A0A3Q2LHE3_BIK-01      acagtgacaaccgtgactctgtggccatgcggctggccttcatcggggac

A0A3Q2LHE3_BIK-02      gagatggaagtgagatggatgctgccccacatcgctgagctgcctggggt
A0A3Q2LHE3_BIK-01      gagatggaagtgagatggatgctgccccacatcgctgagctgcctggggt

A0A3Q2LHE3_BIK-02      ggccgtgtacagcttggccttcacctacaaccagacaggcctgaggggtg
A0A3Q2LHE3_BIK-01      ggccgtgtacagcttggccttcacctacaaccagacaggcctgaggggtg

A0A3Q2LHE3_BIK-02      tttttagaagtttcatggatggtctcactaacctcagggagaacataagg
A0A3Q2LHE3_BIK-01      tttttagaagtttcatggatggtctcactaacctcagggagaacataagg

A0A3Q2LHE3_BIK-02      ttctggagcttcctgacccgcagggacagggtaagcctgagatttcatga
A0A3Q2LHE3_BIK-01      ttctggagcttcctgacccgcagggacagggtaagcctgagatttcatga

A0A3Q2LHE3_BIK-02      ccttgactcaccttcctgcatgtgtagccctctggagccgtggagcagct
A0A3Q2LHE3_BIK-01      ccttgactcaccttcctgcatgtgtagccctctggagccgtggagcagct

A0A3Q2LHE3_BIK-02      gccccgtagggcacagcctcgctggttgccacagtccccaccaatcccta
A0A3Q2LHE3_BIK-01      gccccgtagggcacagcctcgctggttgccacagtccccaccaatcccta

A0A3Q2LHE3_BIK-02      ttgtcttcttttgcctgcttcacccattcctcctcctgcctgttccctgg
A0A3Q2LHE3_BIK-01      ttgtcttcttttgcctgcttcacccattcctcctcctgcctgttccctgg

A0A3Q2LHE3_BIK-02      gcctttgggtttgagatggctggcttactga
A0A3Q2LHE3_BIK-01      gcctttgggtttgagatggctggcttactga

© 1998-2020Legal notice