Dataset for CDS BMF of organism Equus asinus asinus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4MCB2_BMF-01      atggagtcgcctcagtgtgtagaggagctggaggatgatgtgttccagcc
A0A8C4MCB2_BMF-02      atggagtcgcctcagtgtgtagaggagctggaggatgatgtgttccagcc
                       **************************************************

A0A8C4MCB2_BMF-01      agaggatggggagccggggacccagcccaggagcttgctctctgctgacc
A0A8C4MCB2_BMF-02      agaggatggggagccggggacccagcccaggagcttgctctctgctgacc
                       **************************************************

A0A8C4MCB2_BMF-01      tgtttgccccgagccagctggactgccccctcagccatctgcggctcttc
A0A8C4MCB2_BMF-02      tgtttgccccgagccagctggactgccccctcagccatctgcggctcttc
                       **************************************************

A0A8C4MCB2_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A8C4MCB2_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
                       **************************************************

A0A8C4MCB2_BMF-01      caaggccacccagaccctcagtccagcctccccaagccagggtgtcatgc
A0A8C4MCB2_BMF-02      caaggccacccagaccctcagtccagcctccccaagccagggtgtcatgc
                       **************************************************

A0A8C4MCB2_BMF-01      tgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgct
A0A8C4MCB2_BMF-02      tgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgct
                       **************************************************

A0A8C4MCB2_BMF-01      ggctaccggctccctctccctgccagtttccctgcaggcttgccccttgg
A0A8C4MCB2_BMF-02      ggctaccggctccctctccctgccagtttccctgcaggcttgccccttgg
                       **************************************************

A0A8C4MCB2_BMF-01      tgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
A0A8C4MCB2_BMF-02      tgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
                       **************************************************

A0A8C4MCB2_BMF-01      cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcag
A0A8C4MCB2_BMF-02      cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcag
                       **************************************************

A0A8C4MCB2_BMF-01      caacaccagcagaaccgaaatc----gcgtgtggtgg-------------
A0A8C4MCB2_BMF-02      ca-----agtaggcatgggagcttgggggggtggtgagtcttctggggat
                       **     ** **    *  * *    * * ******              

A0A8C4MCB2_BMF-01      -------cagaccctg--------ctctttctccacaacctc--------
A0A8C4MCB2_BMF-02      ggggggccggggcctgcctcaggactccgtctgccaagcctcaaggataa
                              * *  ****        ***  *** *  * ****        

A0A8C4MCB2_BMF-01      ---------gctttg----aacggagacgaga---acaggaacggggcag
A0A8C4MCB2_BMF-02      ggtcctggagttttggcctaatgctgttgtgattcccgtggactggatgg
                                * ****    ** *  *  * **    *  * ** **   *

A0A8C4MCB2_BMF-01      gtccca---ggtga
A0A8C4MCB2_BMF-02      gcccgactgcgtga
                       * ** *    ****

© 1998-2022Legal notice