Dataset for CDS classical BH3-containing proteins of organism Dromaius novaehollandiae

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4J5J5_BCL2L11      atg----------tcagtttggggcgtga---------------------
A0A8C4K602_PMAIP1-      at-----------gccttctagaataaaa---------------------
A0A8C4J3Z9_BMF-02       atggatcaccccagctacctggaagaggactattctagcctggatgggct
A0A8C4J3Z9_BMF-03       atggatcaccccagctacctggaagaggactattctagcctggatgggct
A0A8C4J3Z9_BMF-01       atggatcaccccagctacctggaagaggactattctagcctggatgggct
A0A8C4J3Z9_BMF-04       atggatcaccccagctacctggaagaggactattctagcctggatgggct
                        **            *    * *      *                     

A0A8C4J5J5_BCL2L11      -----------------------------------atgcaattcaggctg
A0A8C4K602_PMAIP1-      --------------------------------------------------
A0A8C4J3Z9_BMF-02       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C4J3Z9_BMF-03       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C4J3Z9_BMF-01       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
A0A8C4J3Z9_BMF-04       ggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctg
                                                                          

A0A8C4J5J5_BCL2L11      atccgg-----------------ctcatgggaaaccggaaatatggat--
A0A8C4K602_PMAIP1-      --------------------actcttaaaaaataccag------------
A0A8C4J3Z9_BMF-02       gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8C4J3Z9_BMF-03       gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8C4J3Z9_BMF-01       gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
A0A8C4J3Z9_BMF-04       gtgagatgactgcaactggcattttcacacagaaccagtcctacagctgc
                                                * *      *** *            

A0A8C4J5J5_BCL2L11      -------------------------cgcacaggaactgc-ggcgcatcgg
A0A8C4K602_PMAIP1-      --------------------------------aggctcctggagtcgcgg
A0A8C4J3Z9_BMF-02       cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8C4J3Z9_BMF-03       cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8C4J3Z9_BMF-01       cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
A0A8C4J3Z9_BMF-04       cttctggggaggtttcaactatttcccctcacacactgctgtggtcccgg
                                                           ** * *  *   ***

A0A8C4J5J5_BCL2L11      cgacgaattcaatgcctcctattgtccgagaagggt-------aattttc
A0A8C4K602_PMAIP1-      ca-cgg-------gc----------gcgggac------------------
A0A8C4J3Z9_BMF-02       tagcag-------gcatcctgagcagcaggacaaggcaactcaaacactc
A0A8C4J3Z9_BMF-03       tagcag-------gcatcctgagcagcaggacaaggcaactcaaacactc
A0A8C4J3Z9_BMF-01       tagcag-------gcatcctgagcagcaggacaaggcaactcaaacactc
A0A8C4J3Z9_BMF-04       tagcag-------gcatcctgagcagcaggacaaggcaactcaaacactc
                           *         **           *  **                   

A0A8C4J5J5_BCL2L11      agatttttcttttcc--------------gtttct---------------
A0A8C4K602_PMAIP1-      -----------------------------gctgcc-------ggcgctga
A0A8C4J3Z9_BMF-02       agccagtcctcttccagtcaggatgttatgttgccttgtggagtcactga
A0A8C4J3Z9_BMF-03       agccagtcctcttccagtcaggatgttatgttgccttgtggagtcactga
A0A8C4J3Z9_BMF-01       agccagtcctcttccagtcaggatgttatgttgccttgtggagtcactga
A0A8C4J3Z9_BMF-04       agccagtcctcttccagtcaggatgttatgttgccttgtggagtcactga
                                                     * * *                

A0A8C4J5J5_BCL2L11      ----------------ttctctgcaaataccctgttgccttttcccgttt
A0A8C4K602_PMAIP1-      gg--------------------------gcttgt------------gtct
A0A8C4J3Z9_BMF-02       agagccccggagactcttctatgggaatgctggttaccgtttacacgttc
A0A8C4J3Z9_BMF-03       agagccccggagactcttctatgggaatgctggttaccgtttacacgttc
A0A8C4J3Z9_BMF-01       agagccccggagactcttctatgggaatgctggttaccgtttacacgttc
A0A8C4J3Z9_BMF-04       agagccccggagactcttctatgggaatgctggttaccgtttacacgttc
                                                     *                **  

A0A8C4J5J5_BCL2L11      ctcttttcttcttctc----------------------------------
A0A8C4K602_PMAIP1-      cgt------gctttgcag--------------------------------
A0A8C4J3Z9_BMF-02       cttcagttggctttgcattggatccacatctccaagaggagccgcaggaa
A0A8C4J3Z9_BMF-03       cttcagttggctttgcattggatccacatctccaagaggagccgcaggaa
A0A8C4J3Z9_BMF-01       cttcagttggctttgcattggatccacatctccaagaggagccgcaggaa
A0A8C4J3Z9_BMF-04       cttcagttggctttgcattggatccacatctccaagaggagccgcaggaa
                        *         ***  *                                  

A0A8C4J5J5_BCL2L11      ----taccaagaccacgagc-----tacatgccacccaggtgttggag--
A0A8C4K602_PMAIP1-      ----agcaggaagcggtggccga-gtgcgccgtgc-----agctgcgccg
A0A8C4J3Z9_BMF-02       ggtcagcgggaagcacgtgctgaggtgcagattgcacggaagttgcagtg
A0A8C4J3Z9_BMF-03       ggtcagcgggaagcacgtgctgaggtgcagattgcacggaagttgcagtg
A0A8C4J3Z9_BMF-01       ggtcagcgggaagcacgtgctgaggtgcagattgcacggaagttgcagtg
A0A8C4J3Z9_BMF-04       ggtcagcgggaagcacgtgctgaggtgcagattgcacggaagttgcagtg
                              *    * *    **     * *      *      * **     

A0A8C4J5J5_BCL2L11      ------aaaaccctaccatcagctttctat--------------------
A0A8C4K602_PMAIP1-      catcggggacaagtggaacctgcgcca-----------------------
A0A8C4J3Z9_BMF-02       cattgcagaccagttccaccggctccacgtgcaga---------------
A0A8C4J3Z9_BMF-03       cattgcagaccagttccaccggctccacgtgcagaggcatcagcagaaca
A0A8C4J3Z9_BMF-01       cattgcagaccagttccaccggctccacgtgcagaggcatcagcagaaca
A0A8C4J3Z9_BMF-04       cattgcagaccagttccaccggctccacgtgcagaggcatcagcagaaca
                                *    *   * * **                           

A0A8C4J5J5_BCL2L11      ------------gagggtgttaaatggcctcg---aacaagtt-------
A0A8C4K602_PMAIP1-      ------------gaagatcctcaaccttctcgcgaagctgttctgcc---
A0A8C4J3Z9_BMF-02       ------------ggggacactgtttgttcaatccaggcaactgtgtc-aa
A0A8C4J3Z9_BMF-03       gaaatcaagtgtggtggcagctttttctctttctacacaacttggcctta
A0A8C4J3Z9_BMF-01       gaaatcaagtgtggtggcagctttttctctttctacacaacttggcctta
A0A8C4J3Z9_BMF-04       gaaatcaagtgtggtggcagctttttctctttctacacaacttggcctta
                                    *  *            *        *   *        

A0A8C4J5J5_BCL2L11      ------------------agg-----------------------------
A0A8C4K602_PMAIP1-      ----cgg-----------agacg---------------------------
A0A8C4J3Z9_BMF-02       ggtatggggatcctcagcaggaggacagcggaacggtttgtacg------
A0A8C4J3Z9_BMF-03       aatgtgg-----------aggcgaacag-gaaccacactgggcagagcca
A0A8C4J3Z9_BMF-01       aatgtgg-----------aggcgaacag-gaaccacactgggca------
A0A8C4J3Z9_BMF-04       aatgtgg-----------aggcgaacag-gaaccacactgggca------
                                          **                              

A0A8C4J5J5_BCL2L11      --------------------------------------------------
A0A8C4K602_PMAIP1-      --------------------------------------------------
A0A8C4J3Z9_BMF-02       --tatgtgagagcccaagcagaagctcggatgaacgc-------------
A0A8C4J3Z9_BMF-03       cagaaaggagggtctcttcctg----------------------------
A0A8C4J3Z9_BMF-01       -------gagg---------------------------------------
A0A8C4J3Z9_BMF-04       -------gagggtcctttcatcaggtgcagtcatagaccagcagatcaaa
                                                                          

A0A8C4J5J5_BCL2L11      ---------tag
A0A8C4K602_PMAIP1-      ---------tga
A0A8C4J3Z9_BMF-02       ---------tga
A0A8C4J3Z9_BMF-03       ---------tga
A0A8C4J3Z9_BMF-01       ---------tga
A0A8C4J3Z9_BMF-04       gctgcatcataa
                                 *  

© 1998-2022Legal notice