Dataset for CDS BCL2L11 of organism Dipodomys ordii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1S3FFM9_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtgg
A0A1S3FFM9_BCL2L11      atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtgg

A0A1S3FFM9_BCL2L11      acagttgcagcctgctgagaggcctccccagctcaggcctggggccccta
A0A1S3FFM9_BCL2L11      acagttgcagcctgctgagaggcctccccagctcaggcctggggccccta

A0A1S3FFM9_BCL2L11      cctccctacagacagagcagca----------------------------
A0A1S3FFM9_BCL2L11      cctccctacagacagagcagcaaggtaatcccgaaggcagtcccgaaggc

A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      gaaggggaccgctgcccccaaggcagccctcagggcccgctggccccacc

A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga

A0A1S3FFM9_BCL2L11      --------------------------------------------------
A0A1S3FFM9_BCL2L11      gaagatcttccctgctgtctcgatcctccagtgggtatttctcttttgac

A0A1S3FFM9_BCL2L11      --agacaggagcccggcacccatgagttgtgacaaatcaacacaaacccc
A0A1S3FFM9_BCL2L11      acagacaggagcccggcacccatgagttgtgacaaatcaacacaaacccc

A0A1S3FFM9_BCL2L11      aagtcctccctgccaggccttcaaccattatctcagcgcaatggcttcca
A0A1S3FFM9_BCL2L11      aagtcctccctgccaggccttcaaccattatctcagcgcaatggcttcca

A0A1S3FFM9_BCL2L11      tgaggcagtctcaggaagagcctgcagatttgcgcccagagatatggatc
A0A1S3FFM9_BCL2L11      tgaggcagtctcaggaagagcctgcagatttgcgcccagagatatggatc

A0A1S3FFM9_BCL2L11      gcccaggaattgcggcgtattggagacgagtttgatgcctattatccaag
A0A1S3FFM9_BCL2L11      gcccaggaattgcggcgtattggagacgagtttgatgcctattatccaag

A0A1S3FFM9_BCL2L11      gagggtatttttgaataattaccaagcagccgaagaccaaccccaaatgg
A0A1S3FFM9_BCL2L11      gagggtatttttgaataattaccaagcagccgaagaccaaccccaaatgg

A0A1S3FFM9_BCL2L11      ttatcttacggctgttacgttacatcattcgcctggtgtggagaatgcat
A0A1S3FFM9_BCL2L11      ttatcttacggctgttacgttacatcattcgcctggtgtggagaatgcat

A0A1S3FFM9_BCL2L11      tga
A0A1S3FFM9_BCL2L11      tga

© 1998-2020Legal notice