Dataset for CDS BCL2L11 of organism Delphinapterus leucas

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      atgttcccggcggctgcggtcggggtagcgcgtaccggagacgcggcgtg
                                                                          

A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      cggagccctcagctgcccggcggagcgcggcagcggacgggcggcgagtt
                                                                          

A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      gcaggctctccgctgccccgggcgctccgaccgcgagtcccgggctttgt
                                                                          

A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      ctcccgggccgccttcgtgttgacggtcagggggctccgggtcggcgaag
                                                                          

A0A2Y9Q753_BCL2L11      --------------------------------------------------
A0A2Y9Q753_BCL2L11      ggcgcgggctgggcgccgccgggccccggcccggacgcgacgctcggaag
                                                                          

A0A2Y9Q753_BCL2L11      --------------------------atggcaaagcaaccttccgatgta
A0A2Y9Q753_BCL2L11      ggaaggggcggacaaaaaaagaccaaatggcaaagcaaccttccgatgta
                                                  ************************

A0A2Y9Q753_BCL2L11      agttctgagtgtgacagagaaggtggacaattgcagcctgccgaaaggcc
A0A2Y9Q753_BCL2L11      agttctgagtgtgacagagaaggtggacaattgcagcctgccgaaaggcc
                        **************************************************

A0A2Y9Q753_BCL2L11      tcctcagctcaggcctggggcccccatctctctacagacagagcggcaag
A0A2Y9Q753_BCL2L11      tcctcagctcaggcctggggcccccatctctctacagacagagcggca--
                        ************************************************  

A0A2Y9Q753_BCL2L11      gtaatcccgaaggagaaggggaccgctgcccccaaggcagcccacagggc
A0A2Y9Q753_BCL2L11      --------------------------------------------------
                                                                          

A0A2Y9Q753_BCL2L11      ccactggccccaccggccagtcccggccctttcgctaccagatccccgct
A0A2Y9Q753_BCL2L11      --------------------------------------------------
                                                                          

A0A2Y9Q753_BCL2L11      tttcatcttcgtgagaagatcttccctgctgtctcgatcctccagtgggt
A0A2Y9Q753_BCL2L11      --------------------------------------------------
                                                                          

A0A2Y9Q753_BCL2L11      atttctcttttgacacagacaggagcccggcacccatgagttgtgacaaa
A0A2Y9Q753_BCL2L11      ----------------agacaggagcccggcacccatgagttgtgacaaa
                                        **********************************

A0A2Y9Q753_BCL2L11      tcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcag
A0A2Y9Q753_BCL2L11      tcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcag
                        **************************************************

A0A2Y9Q753_BCL2L11      tgcgatggcttccatgaggcagtctcaggctgtacctgcagatatgcgtc
A0A2Y9Q753_BCL2L11      tgcgatggcttccatgaggcagtctcaggctgtacctgcagatatgcgtc
                        **************************************************

A0A2Y9Q753_BCL2L11      cggagatatggattgcgcaagagttgcggcgtattggagacgaatttaat
A0A2Y9Q753_BCL2L11      cggagatatggattgcgcaagagttgcggcgtattggagacgaatttaat
                        **************************************************

A0A2Y9Q753_BCL2L11      gcatattacccaaggagggtctttctgaataatcaccaagcagccgaagg
A0A2Y9Q753_BCL2L11      gcatattacccaaggagggtctttctgaataatcaccaagcagccgaagg
                        **************************************************

A0A2Y9Q753_BCL2L11      tcacccgcaaatggttatcttacggctcttacgccacatcgtccgtctgg
A0A2Y9Q753_BCL2L11      tcacccgcaaatggttatcttacggctcttacgccacatcgtccgtctgg
                        **************************************************

A0A2Y9Q753_BCL2L11      tgtggaggatgcagtga
A0A2Y9Q753_BCL2L11      tgtggaggatgcagtga
                        *****************

© 1998-2020Legal notice