Dataset for CDS BCL2L11 of organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

B2KKY9_BCL2L11-01      atgtctgacacgtccagagagcaaacgctggccaatggcccggcctcgca
B8JK68_BCL2L11-01      atgtctgacacgtccagagagcaaacgctggccaatggcccggcctcgca

B2KKY9_BCL2L11-01      gggaagcggagagagcaccggtggcggagtggtgttgcccgccgggcact
B8JK68_BCL2L11-01      gggaagcggagagagcaccggtggcggagtggtgttgcccgccgggcact

B2KKY9_BCL2L11-01      ttgatttccctcagccgggcgaaggggacccgttaaggggagggatatcc
B8JK68_BCL2L11-01      ttgatttccctcagccgggcgaaggggacccgttaaggggagggatatcc

B2KKY9_BCL2L11-01      atgtcgaataaccagtcgaggtcaccgatgaaccggactttctccaggtc
B8JK68_BCL2L11-01      atgtcgaataaccagtcgaggtcaccgatgaaccggactttctccaggtc

B2KKY9_BCL2L11-01      ctctagtggctatttttccgtcgacagcgattctgtgccaggttcccctc
B8JK68_BCL2L11-01      ctctagtggctatttttccgtcgacagcgattctgtgccaggttcccctc

B2KKY9_BCL2L11-01      taatgcccaatatttccgaagcgcaagacggacaaaatgatgaggtatgg
B8JK68_BCL2L11-01      taatgcccaatatttccgaagcgcaagacggacaaaatgatgaggtatgg

B2KKY9_BCL2L11-01      ttatcagaacatagccaccagcacttgcagatggcagcaccagtcgcagc
B8JK68_BCL2L11-01      ttatcagaacatagccaccagcacttgcagatggcagcaccagtcgcagc

B2KKY9_BCL2L11-01      cctgccgccggagatggtggtcgctcgtgaactgcgacgcataggcgatg
B8JK68_BCL2L11-01      cctgccgccggagatggtggtcgctcgtgaactgcgacgcataggcgatg

B2KKY9_BCL2L11-01      agttcaatcgcctctactgtgaggccggagcaggagtgaaccagctgcgt
B8JK68_BCL2L11-01      agttcaatcgcctctactgtgaggccggagcaggagtgaaccagctgcat
                       ************************************************ *

B2KKY9_BCL2L11-01      gctcccaacgaacacgccatcgtcctgtggatgaacgtcattatcggacg
B8JK68_BCL2L11-01      gctcccaacgaacacgccatcgtcctgtggatgaacgacattatcggacg
                       ************************************* ************

B2KKY9_BCL2L11-01      cctagtacactttttcctgcgaagaagatga
B8JK68_BCL2L11-01      cctagtacactttttcctgcgaagaagatga

© 1998-2022Legal notice