Dataset for CDS classical BH3-containing proteins of organism Cyprinodon variegatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2D5S0_BAD-01      atggctcagtcggtagagact---------tcggatcctattatggctgc
A0A3Q2CXC4_BMF-02      atggaggaggaggaggatgatgtgtttgagccagatccca--acagctgg
A0A3Q2CXC4_BMF-01      atggaggaggaggaggatgatgtgtttgagccagatccca--acagctgg
                       ****   **  **  **   *          * ***** *  *  **** 

A0A3Q2D5S0_BAD-01      aacctttaccattt----------------cagacagcgacactgagcca
A0A3Q2CXC4_BMF-02      caca--caccattcagggagataaagtttgaagaccggggcacacaaacg
A0A3Q2CXC4_BMF-01      caca--caccattcagggagataaagtttgaagaccggggcacacaaacg
                        **    ******                  **** * * ***  *  * 

A0A3Q2D5S0_BAD-01      tcagaggaggtggaggaaacaagaaac-----------------------
A0A3Q2CXC4_BMF-02      cccggtcctggcgtggcaccacataacgttatgctgccctgtggagttgt
A0A3Q2CXC4_BMF-01      cccggtcctggcgtggcaccacataacgttatgctgccctgtggagttgt
                        * *     *  * ** * **   ***                       

A0A3Q2D5S0_BAD-01      -aaggagccaaggatacgaaacagtgggaaaacacatcgtcggat-----
A0A3Q2CXC4_BMF-02      ggaggagcccagaccacttttctaccgtaacgcaggttttcgattgcact
A0A3Q2CXC4_BMF-01      ggaggagcccagaccacttttctaccgtaacgcaggttttcgattgcact
                         ******* **   **    *    * **  **  *  ***  *     

A0A3Q2D5S0_BAD-01      --------cagactgagctc-----ggagtctcacgctttcaccagagag
A0A3Q2CXC4_BMF-02      tcccagcacattttgagcttgtcggggattttgacgt-------------
A0A3Q2CXC4_BMF-01      tcccagcacattttgagcttgtcggggattttgacgt-------------
                               **   ******      *** * * ***              

A0A3Q2D5S0_BAD-01      gaggaggccaggggggaggaggaggtcgggacccccactgagggctatcc
A0A3Q2CXC4_BMF-02      aaggcgacaagcggagcacaacaggatggagc----------agttacct
A0A3Q2CXC4_BMF-01      aaggcgacaagcggagcacaacaggatggagc----------agttacct
                        *** * * ** ** *   *  ***  **  *           * ** * 

A0A3Q2D5S0_BAD-01      attcaggggccgatctaattcagctcctccagctctgtgggctgccaaga
A0A3Q2CXC4_BMF-02      ttgcaacagccgg-------cagcac--tcagcttggaggcctgca----
A0A3Q2CXC4_BMF-01      ttgcaacagccgg-------cagcac--tcagcttggaggcctgca----
                        * **   ****        **** *   *****  * ** ****     

A0A3Q2D5S0_BAD-01      agtacggccggcagcttcgaaggatgagtgatgagtttgtcaccctgctt
A0A3Q2CXC4_BMF-02      ---tcgggcagaaacttcagataataggcgaccagtt--tcacc------
A0A3Q2CXC4_BMF-01      ---tcgggcagaaacttcagataataggcgaccagtt--tcacc------
                           *** * * * ****  *  **  * **  ****  *****      

A0A3Q2D5S0_BAD-01      gataaaggggagttgaggaagg----------------------------
A0A3Q2CXC4_BMF-02      -----gggaacacttacaacagatcccaggacagcccttcccccacctag
A0A3Q2CXC4_BMF-01      -----gggaacacttacaacag-------------------------ta-
                             **     * *  *  *                            

A0A3Q2D5S0_BAD-01      -tgagcagcacggggacgaaca--gaccaatacgc-----cattccaaga
A0A3Q2CXC4_BMF-02      ttcaccaacacca-----------ggcccttaccctgcctcct-cttcct
A0A3Q2CXC4_BMF-01      -tcatcaaaaccaaaggaatcaggggccgctgtggtggcgcatgactgca
                        * * **  **             * **  *         * *       

A0A3Q2D5S0_BAD-01      gctggtggagctacctcttcagtcaccaggagatggagggagagaacagt
A0A3Q2CXC4_BMF-02      gtttat----ttctctctcctttcccctgtgg------------------
A0A3Q2CXC4_BMF-01      gctctt----ctcagcctcctgtttgataggg------------------
                       * *  *     *    ** *  *        *                  

A0A3Q2D5S0_BAD-01      caccatgaaaaccacacgcaatgcactgaacaaagaggagaataa
A0A3Q2CXC4_BMF-02      -------------tcccgttgtgctgtggaggcaagtggcattga
A0A3Q2CXC4_BMF-01      -------------g---gttgattggtggagcaggatggaggtga
                                        *        ** *       *    * *

© 1998-2020Legal notice