Dataset for CDS BAD of organism Ctenopharyngodon idella

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8F1NN26_BAD-01      atgg----cac---------------aaatg--ttcagtatctc---tga
A0A8F1NN29_BAD-01      atggataacacattgcatgaccatcaagatgattccagcgccttggatgg
                       ****    ***               * ***  * ***   **    ** 

A0A8F1NN26_BAD-01      caatgagtc------------agagacatcggaagaccgtgaggacccc-
A0A8F1NN29_BAD-01      caaaaagacatcacatctggaagagacaatcaagaaccatgggcaacatc
                       ***  ** *            *******    *  *** ** * * *   

A0A8F1NN26_BAD-01      --gaccagacagaacataacagtggattgccgcaggggaa---gcagctc
A0A8F1NN29_BAD-01      aggatcaaaccttgccaaacatt---tctcctcaaaggcgtgtgcggctc
                         ** ** **    *  **** *   *  ** **  **     ** ****

A0A8F1NN26_BAD-01      cgcactgtgcctgatagcctgaaaggcgagcaactgg--ggaggcagaga
A0A8F1NN29_BAD-01      tattcagagtctca-ggtgtatacagtcagccgctggcaggacgcagag-
                           * * * ** *  *  *  *  *  ***  ****  *** ****** 

A0A8F1NN26_BAD-01      aatctctcgatgaatgaggatctgct--ggaggccggggcagcagatgaa
A0A8F1NN29_BAD-01      -----ccccaggatggagcatcggcggaggagaacggaggagcgggagat
                            * * * **  *** *** **   ****  *** * *** *  ** 

A0A8F1NN26_BAD-01      ggcgat---ttcaggcctagatctcgctctgctcctcctgctttgtgggc
A0A8F1NN29_BAD-01      ggacttccattcagaggtcgttctcaatccgctcctgctgcgctgtggaa
                       **   *   *****   * * ****  ** ****** ****  *****  

A0A8F1NN26_BAD-01      tgctaagaaatatggccgacagctaaggagaatgagcgatgagtttgaca
A0A8F1NN29_BAD-01      agcaaagaagtatgggcggcagctgaggagaatgagcgatgaatttgaca
                        ** ***** ***** ** ***** ***************** *******

A0A8F1NN26_BAD-01      tcctccttgataaagggatgaagagggtgaagagcgcaggaacagcacgt
A0A8F1NN29_BAD-01      catggcttgacaaagg------ggaggtgaaaagagt-gaaacagaccta
                            ***** *****      *  ****** ** *  * *****  *  

A0A8F1NN26_BAD-01      cagatgcagcaatcacccagctggttggccttcctttggagtcacaaaga
A0A8F1NN29_BAD-01      caga--------------ggatggttctcattcctctggagtcccaaaga
                       ****               * *****  * ***** ******* ******

A0A8F1NN26_BAD-01      gtctgatgctgagtcgcgccctgcagagtga
A0A8F1NN29_BAD-01      a---------gaggagggc---agagaatga
                                 ***  * **     *** ***

© 1998-2022Legal notice