Dataset for CDS BCL2L11 of organism Crocodylus porosus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A7M4F197_BCL2L11      cgtagtgggcgcagcccgcgacggccgggccccgcgcagacttgctgcgc
A0A7M4F197_BCL2L11      --------------------------------------------------

A0A7M4F197_BCL2L11      tcagcacattcgggagaacaatgggctgggacggggccgcggccgggcgg
A0A7M4F197_BCL2L11      --------------------atgggctgggacggggccgcggccgggcgg

A0A7M4F197_BCL2L11      ctcctcctcgccgccgccccctcctgctcgccggctgcggggcgggcaca
A0A7M4F197_BCL2L11      ctcctcctcgccgccgccccctcctgctcgccggctgcggggcgggcaca

A0A7M4F197_BCL2L11      gcgcggacccgccgctctctcgccctcccagtcccaacacagcaagtttc
A0A7M4F197_BCL2L11      gcgcggacccgccgctctctcgccctcccagtcccaacacagcaagtttc

A0A7M4F197_BCL2L11      gggcagagccgggagggctcggagcggagctgcttggctcgcaagtttca
A0A7M4F197_BCL2L11      gggcagagccgggagggctcggagcggagctgcttggctcgcaagtttca

A0A7M4F197_BCL2L11      cttcaaaatgtaatggcttttgtcggcggccggctgactccaggagcgct
A0A7M4F197_BCL2L11      cttcaaaatgtaatggcttttgtcggcggccggctgactccaggagcgct

A0A7M4F197_BCL2L11      ccggtcgggaccgctgggggtttttggtctgtggaaaaaggcagtgcgtt
A0A7M4F197_BCL2L11      ccggtcgggaccgctgggggtttttggtctgtggaaaaaggca-------

A0A7M4F197_BCL2L11      gttgtcgtatttctttgtttgtttgtttgtctgtctgtttgtgcggagca
A0A7M4F197_BCL2L11      --------------------------------------------------

A0A7M4F197_BCL2L11      gttgcgggagatgctttgcatccagtcacttccctgatttaatcctgtcg
A0A7M4F197_BCL2L11      --------------------------------------------------

A0A7M4F197_BCL2L11      gacggagcttgtttctcagaacttggggatggcgctgtgtggctgcaaag
A0A7M4F197_BCL2L11      --------------------------------------------------

A0A7M4F197_BCL2L11      ccccgatgttgtgtcgctgtggagccgggagagcttactcgcgatgcttt
A0A7M4F197_BCL2L11      --------------------------------------------------

A0A7M4F197_BCL2L11      ctctttctctgcagggaaaaaaagaccaaatggcaaaacaaccctctgat
A0A7M4F197_BCL2L11      --------------ggaaaaaaagaccaaatggcaaaacaaccctctgat

A0A7M4F197_BCL2L11      ttgaattccaagtgcggcagtgaagacagacagttgcagccccgtgaaag
A0A7M4F197_BCL2L11      ttgaattccaagtgcggcagtgaagacagacagttgcagccccgtgaaag

A0A7M4F197_BCL2L11      gccaagtcagcctcagcccgttaggcctggggcccctacctctatacaaa
A0A7M4F197_BCL2L11      gccaagtcagcctcagcccgttaggcctggggcccctacctctatacaaa

A0A7M4F197_BCL2L11      cacagtatcaa---------------------------------------
A0A7M4F197_BCL2L11      cacagtatcaagacaggagtcctgcgcctatgagttgcgacaagtccaca

A0A7M4F197_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      cagactccaagtcccccatgtcaagcctttaatcattatttaagtgcaat

A0A7M4F197_BCL2L11      ----------------gcttccaggtggcaatatcgatcaatacctgaag
A0A7M4F197_BCL2L11      gggtaagcaagatcatgcttccaggtggcaatatcgatcaatacctgaag

A0A7M4F197_BCL2L11      atatgcagccagaaatatggattgcacaggaattacggcggattggagac
A0A7M4F197_BCL2L11      atatgcagccagaaatatggattgcacaggaattacggcggattggagac

A0A7M4F197_BCL2L11      gaatttaatgcttcctattgcccaagacggggcttctgggataaccaagg
A0A7M4F197_BCL2L11      gaatttaatgcttcctattgcccaagacggggcttctgggataaccaagg

A0A7M4F197_BCL2L11      agtaaatcaccaaattattttgcgcctcttgcattatatcatccgcctca
A0A7M4F197_BCL2L11      agtaaatcaccaaattattttgcgcctcttgcattatatcatccgcctca

A0A7M4F197_BCL2L11      tttggagaagacagtga
A0A7M4F197_BCL2L11      tttggagaagacagtga

© 1998-2022Legal notice