Dataset for CDS BCL2L11 of organism Crocodylus porosus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7M4F197_BCL2L11      cgtagtgggcgcagcccgcgacggccgggccccgcgcagacttgctgcgc
A0A7M4F197_BCL2L11      --------------------------------------------------
                                                                          

A0A7M4F197_BCL2L11      tcagcacattcgggagaacaatgggctgggacggggccgcggccgggcgg
A0A7M4F197_BCL2L11      --------------------atgggctgggacggggccgcggccgggcgg
                                            ******************************

A0A7M4F197_BCL2L11      ctcctcctcgccgccgccccctcctgctcgccggctgcggggcgggcaca
A0A7M4F197_BCL2L11      ctcctcctcgccgccgccccctcctgctcgccggctgcggggcgggcaca
                        **************************************************

A0A7M4F197_BCL2L11      gcgcggacccgccgctctctcgccctcccagtcccaacacagcaagtttc
A0A7M4F197_BCL2L11      gcgcggacccgccgctctctcgccctcccagtcccaacacagcaagtttc
                        **************************************************

A0A7M4F197_BCL2L11      gggcagagccgggagggctcggagcggagctgcttggctcgcaagtttca
A0A7M4F197_BCL2L11      gggcagagccgggagggctcggagcggagctgcttggctcgcaagtttca
                        **************************************************

A0A7M4F197_BCL2L11      cttcaaaatgtaatggcttttgtcggcggccggctgactccaggagcgct
A0A7M4F197_BCL2L11      cttcaaaatgtaatggcttttgtcggcggccggctgactccaggagcgct
                        **************************************************

A0A7M4F197_BCL2L11      ccggtcgggaccgctgggggtttttggtctgtggaaaaaggcagtgcgtt
A0A7M4F197_BCL2L11      ccggtcgggaccgctgggggtttttggtctgtggaaaaaggca-------
                        *******************************************       

A0A7M4F197_BCL2L11      gttgtcgtatttctttgtttgtttgtttgtctgtctgtttgtgcggagca
A0A7M4F197_BCL2L11      --------------------------------------------------
                                                                          

A0A7M4F197_BCL2L11      gttgcgggagatgctttgcatccagtcacttccctgatttaatcctgtcg
A0A7M4F197_BCL2L11      --------------------------------------------------
                                                                          

A0A7M4F197_BCL2L11      gacggagcttgtttctcagaacttggggatggcgctgtgtggctgcaaag
A0A7M4F197_BCL2L11      --------------------------------------------------
                                                                          

A0A7M4F197_BCL2L11      ccccgatgttgtgtcgctgtggagccgggagagcttactcgcgatgcttt
A0A7M4F197_BCL2L11      --------------------------------------------------
                                                                          

A0A7M4F197_BCL2L11      ctctttctctgcagggaaaaaaagaccaaatggcaaaacaaccctctgat
A0A7M4F197_BCL2L11      --------------ggaaaaaaagaccaaatggcaaaacaaccctctgat
                                      ************************************

A0A7M4F197_BCL2L11      ttgaattccaagtgcggcagtgaagacagacagttgcagccccgtgaaag
A0A7M4F197_BCL2L11      ttgaattccaagtgcggcagtgaagacagacagttgcagccccgtgaaag
                        **************************************************

A0A7M4F197_BCL2L11      gccaagtcagcctcagcccgttaggcctggggcccctacctctatacaaa
A0A7M4F197_BCL2L11      gccaagtcagcctcagcccgttaggcctggggcccctacctctatacaaa
                        **************************************************

A0A7M4F197_BCL2L11      cacagtatcaa---------------------------------------
A0A7M4F197_BCL2L11      cacagtatcaagacaggagtcctgcgcctatgagttgcgacaagtccaca
                        ***********                                       

A0A7M4F197_BCL2L11      --------------------------------------------------
A0A7M4F197_BCL2L11      cagactccaagtcccccatgtcaagcctttaatcattatttaagtgcaat
                                                                          

A0A7M4F197_BCL2L11      ----------------gcttccaggtggcaatatcgatcaatacctgaag
A0A7M4F197_BCL2L11      gggtaagcaagatcatgcttccaggtggcaatatcgatcaatacctgaag
                                        **********************************

A0A7M4F197_BCL2L11      atatgcagccagaaatatggattgcacaggaattacggcggattggagac
A0A7M4F197_BCL2L11      atatgcagccagaaatatggattgcacaggaattacggcggattggagac
                        **************************************************

A0A7M4F197_BCL2L11      gaatttaatgcttcctattgcccaagacggggcttctgggataaccaagg
A0A7M4F197_BCL2L11      gaatttaatgcttcctattgcccaagacggggcttctgggataaccaagg
                        **************************************************

A0A7M4F197_BCL2L11      agtaaatcaccaaattattttgcgcctcttgcattatatcatccgcctca
A0A7M4F197_BCL2L11      agtaaatcaccaaattattttgcgcctcttgcattatatcatccgcctca
                        **************************************************

A0A7M4F197_BCL2L11      tttggagaagacagtga
A0A7M4F197_BCL2L11      tttggagaagacagtga
                        *****************

© 1998-2021Legal notice