Dataset for CDS BCL2L11 of organism Coturnix japonica

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2TW35_BCL2L11      at--ggccaagcagccccccgaggcgaaggcgccccgcgaccgccgggcc
A0A8C2TYI5_BCL2L11      atggggccgggcgg------ggagcggcggcg---------ggaggagga
                        **  ****  ** *      *  ***  ****          *  * *  

A0A8C2TW35_BCL2L11      gggcggctgccgccgggagaggggccgggcccggccgtcccgttgcggcc
A0A8C2TYI5_BCL2L11      ggagaagaggaggaggaggaaggggcgggcagggccg-------------
                        **      *  *  **  ** *** *****  *****             

A0A8C2TW35_BCL2L11      cggagcccccgccgcgttgcccggcgccgcccggcccgc-----ctcgcc
A0A8C2TYI5_BCL2L11      ----gctcccgccgctcagc---gctccgctccgcccgcagaaatacaac
                            ** ********   **   ** **** * ******       *  *

A0A8C2TW35_BCL2L11      cggcagccccgggccgttcgccatccgctcgccgctcttcttcttcgtgc
A0A8C2TYI5_BCL2L11      cagaa-----------------------------------------atat
                        * * *                                          *  

A0A8C2TW35_BCL2L11      ggagatccccgctgctgcagcgctcctccagcgggtacttctccttcgag
A0A8C2TYI5_BCL2L11      ggattgcacaggagctgcggcg---------------------catcggg
                        ***   * * *  ***** ***                     * *** *

A0A8C2TW35_BCL2L11      gccgagcgcagccccgcgcccatgagctgcgataaggccacgcagacccc
A0A8C2TYI5_BCL2L11      gatgaattcaatgcctc---------------------------------
                        *  **   **   ** *                                 

A0A8C2TW35_BCL2L11      cagcccgccgtgccaggccgtcagccactacctgagcgccatgggtgagg
A0A8C2TYI5_BCL2L11      --------------------------------------ctattgtccaag
                                                              * ** *   * *

A0A8C2TW35_BCL2L11      aattgggtaattcggcat--------cgatccaccttgacaaagaggttg
A0A8C2TYI5_BCL2L11      aa--gggtaattttttcttatttttactttccatttctttacgcacggtc
                        **  ********     *        *  ****  *    *   * * * 

A0A8C2TW35_BCL2L11      agcaagcgggagtggctgctgtgctatcctgtctccaagccagctccatg
A0A8C2TYI5_BCL2L11      tctaaaagggaaaagct------taatcatatctggaaactag-------
                           **  ****   ***        *** * ***  ** * **       

A0A8C2TW35_BCL2L11      cactgcggatgcatggtgagctga
A0A8C2TYI5_BCL2L11      ------------------------
                                                

© 1998-2022Legal notice