Dataset for CDS PMAIP1 of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5JY17_PMAIP1-      atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggc
A0A2K5JY17_PMAIP1-      atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggc
                        **************************************************

A0A2K5JY17_PMAIP1-      tcaggcaggtactgacccgctggggccagcgaagacccaggctgggcggg
A0A2K5JY17_PMAIP1-      tcaggcag------------------------------------------
                        ********                                          

A0A2K5JY17_PMAIP1-      gtcggggccggggcaaaaagctcctctcctccccacttgcccttccgcgg
A0A2K5JY17_PMAIP1-      --------------------------------------------------
                                                                          

A0A2K5JY17_PMAIP1-      ggccacgaggaacaagtgcaagtagctcgaagtcgagtgtgctactcaac
A0A2K5JY17_PMAIP1-      -----------------------agctcgaagtcgagtgtgctactcaac
                                               ***************************

A0A2K5JY17_PMAIP1-      tcaggagatttggagacaaactgaacttccggcagaaacttctgaatctg
A0A2K5JY17_PMAIP1-      tcaggagatttggagacaaactgaacttccggcagaaacttctgaatctg
                        **************************************************

A0A2K5JY17_PMAIP1-      atagccaaactcttctgctcaggaacctgactgcaacaaaaacttgcatg
A0A2K5JY17_PMAIP1-      atagccaaactcttctgctcaggaacctga--------------------
                        ******************************                    

A0A2K5JY17_PMAIP1-      aggggactccaaaagagaatttttctcaggaggtgcacatttcatcaatt
A0A2K5JY17_PMAIP1-      --------------------------------------------------
                                                                          

A0A2K5JY17_PMAIP1-      tgaagcaagattgcattgtaat
A0A2K5JY17_PMAIP1-      ----------------------
                                              

© 1998-2020Legal notice