Dataset for CDS BCL2L11 of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5HZI5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
A0A2K5HZI5_BCL2L11      atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtag
                        **************************************************

A0A2K5HZI5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
A0A2K5HZI5_BCL2L11      acaattgcagcctgcggagaggcctccccagctcagacctggggccccta
                        **************************************************

A0A2K5HZI5_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggt
A0A2K5HZI5_BCL2L11      cctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggt
                        **************************************************

A0A2K5HZI5_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
A0A2K5HZI5_BCL2L11      gaaggggacagctgcccccacggcagccctcagggcccgctggccccacc
                        **************************************************

A0A2K5HZI5_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
A0A2K5HZI5_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttatga
                        **************************************************

A0A2K5HZI5_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A2K5HZI5_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                        **************************************************

A0A2K5HZI5_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A2K5HZI5_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                        **************************************************

A0A2K5HZI5_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatgggtgttt
A0A2K5HZI5_BCL2L11      aagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
                        ******************************************** *   *

A0A2K5HZI5_BCL2L11      ttgaataa
A0A2K5HZI5_BCL2L11      gggactag
                          ** ** 

© 1998-2020Legal notice