Dataset for CDS PMAIP1 of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5NJZ2_PMAIP1-      atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaatgcgggc
A0A2K5NJZ2_PMAIP1-      atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccaatgcgggc
                        **************************************************

A0A2K5NJZ2_PMAIP1-      tcaggcaggacaggcagggacggcagggacggcgagggaccaggccggat
A0A2K5NJZ2_PMAIP1-      tcaggcag------------------------------------------
                        ********                                          

A0A2K5NJZ2_PMAIP1-      ttgggattgggatgcagctgcatttcaccagaggcaaagagctcgtctcc
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
                                                                          

A0A2K5NJZ2_PMAIP1-      tcctccccacttgcccttccgcggggccgcgaggaacaagtgcaagtagc
A0A2K5NJZ2_PMAIP1-      -----------------------------------------------agc
                                                                       ***

A0A2K5NJZ2_PMAIP1-      tcgaagtcgagtgtgctactcaactcaggagatttggagacaaactgaac
A0A2K5NJZ2_PMAIP1-      tcgaagtcgagtgtgctactcaactcaggagatttggagacaaactgaac
                        **************************************************

A0A2K5NJZ2_PMAIP1-      ttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaac
A0A2K5NJZ2_PMAIP1-      ttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaac
                        **************************************************

A0A2K5NJZ2_PMAIP1-      ctgactgcatcaaacacttgcataaggggactccaaaagagactttttct
A0A2K5NJZ2_PMAIP1-      ctga----------------------------------------------
                        ****                                              

A0A2K5NJZ2_PMAIP1-      caggaggtgcacacttcatcaatttgaagaaagattgcattgtaattgg
A0A2K5NJZ2_PMAIP1-      -------------------------------------------------
                                                                         

© 1998-2020Legal notice