Dataset for CDS BAD of organism Cebus imitator

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5PDB1_BAD-02      atgttccagatcccagagtttgagccgagtgagcaggaaggctccagctc
A0A2K5PDB1_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaaggctccagctc
A0A2K5PDB1_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaaggctccagctc
                       **************************************************

A0A2K5PDB1_BAD-02      tgcagagaggggcctgaaccccagcaccgcaggggacagccccccaggct
A0A2K5PDB1_BAD-01      tgcagagaggggcctgaaccccagcaccgcaggggacagccccccaggct
A0A2K5PDB1_BAD-03      tgcagagaggggcctgaaccccagcaccgcaggggacagccccccaggct
                       **************************************************

A0A2K5PDB1_BAD-02      ctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcac
A0A2K5PDB1_BAD-01      ctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcac
A0A2K5PDB1_BAD-03      ctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcac
                       **************************************************

A0A2K5PDB1_BAD-02      cagcagggacagccaaccagcagcagccaccatggagggacttcc-----
A0A2K5PDB1_BAD-01      cagcagggacagccaaccagcagcagccacca------------------
A0A2K5PDB1_BAD-03      cagcagggacagccaaccagcagcagccaccatggagagaatcccagtgc
                       ********************************                  

A0A2K5PDB1_BAD-02      --------------------------------------------------
A0A2K5PDB1_BAD-01      --------------------------------------------------
A0A2K5PDB1_BAD-03      aaggatgctctcgaaaacatcagcagggatgtcttccccagccactgact
                                                                         

A0A2K5PDB1_BAD-02      ----------tcgcccgaagagcgcgggcacagcaacgcagatgcggcaa
A0A2K5PDB1_BAD-01      ------------------------------tggaggcgctggggctgtgg
A0A2K5PDB1_BAD-03      cagaagcccaacacacagagaatgtaaagctggaggcgctggggctgtgg
                                                       *   *** *  ** *   

A0A2K5PDB1_BAD-02      agcgccagctggacgcgagtcatccagtcctggtgggat---------cg
A0A2K5PDB1_BAD-01      agacccgg--agtcgccacagatcgtaccccgcagggacggaggaggacg
A0A2K5PDB1_BAD-03      agacccgg--agtcgccacagatcgtaccccgcagggacggaggaggacg
                       **  ** *   * *** *   ***    ** *  ****          **

A0A2K5PDB1_BAD-02      gaacttgggcaggggagga-tccgctccctcccagtgacctt--cgctcc
A0A2K5PDB1_BAD-01      aag---ggatggaggaggagcccagcacctttcggggccgttcgcgctcg
A0A2K5PDB1_BAD-03      aag---ggatggaggaggagcccagcacctttcggggccgttcgcgctcg
                        *    **   * ******  **    ***  * * * * **  ***** 

A0A2K5PDB1_BAD-02      acatcccaaaactcc------acccgctcttatcgccctgagtggccatc
A0A2K5PDB1_BAD-01      gcaccccccaacctctgggcagcacagcgctatggccgcgagc-----tc
A0A2K5PDB1_BAD-03      gcaccccccaacctctgggcagcacagcgctatggccgcgagc-----tc
                        ** ***  ***  *       * *     *** ***  ***      **

A0A2K5PDB1_BAD-02      ttggatatgggc-----------------------ggaagtgcttcctgc
A0A2K5PDB1_BAD-01      cggaggatgagtgacgagttcgtggactcctttaagggacttcctcgccc
A0A2K5PDB1_BAD-03      cggaggatga----------------------------------------
                         *   ***                                         

A0A2K5PDB1_BAD-02      agggagggctgacccag---------------------------------
A0A2K5PDB1_BAD-01      gaagagcgcgggcacagcaacgcagatgcggcaaagcgccagctggacgc
A0A2K5PDB1_BAD-03      --------------------------------------------------
                                                                         

A0A2K5PDB1_BAD-02      -----------------------------------------------att
A0A2K5PDB1_BAD-01      gagtcatccagtcctggtgggatcggaacttgggcaggggaggatccgct
A0A2K5PDB1_BAD-03      --------------------------------------------------
                                                                         

A0A2K5PDB1_BAD-02      cccttccggtgcgtgtga
A0A2K5PDB1_BAD-01      ccctcccagtga------
A0A2K5PDB1_BAD-03      ------------------
                                         

© 1998-2021Legal notice