Dataset for CDS classical BH3-containing proteins of organism Catagonus wagneri

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3W860_PMAIP1-      ----------------atgcctgga-------------------------
A0A8C3X5Q0_BCL2L11      ----------------atggcaaagcaaccttccgatgtaagttctgagt
A0A8C3X5Q0_BCL2L11      ----------------atggcaaagcaaccttccgatgtaagttctgagt
A0A8C3X5Q0_BCL2L11      ----------------atggcaaagcaaccttccgatgtaagttctgagt
A0A8C3X5Q0_BCL2L11      ----------------atggcaaagcaaccttccgatgtaagttctgagt
A0A8C3X5Q0_BCL2L11      ----------------atggcaaagcaaccttccgatgtaagttctgagt
A0A8C3WX89_BMF-01       atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagcc
A0A8C3X9L5_BAD-01       -atgttccagatcccagagtttgagcagagtgagcaggaagactccagcc
A0A8C3XDD1_HRK-01       --------------atgtgtccgtg----------------ccccctgca
A0A8C3WID6_BBC3-01      --------------atg-gcccgagcacgccaggagggcagctccccgga
A0A8C3WID6_BBC3-02      ---ggatccgaccggcg-gcctgag-acgcggcgcaagccacatgc--ga
                                          *                               

A0A8C3W860_PMAIP1-      ------aggaggtctcgtaggaaca-------------------------
A0A8C3X5Q0_BCL2L11      gtgacagagaaggtggacagttgcagcctgccgag------------agg
A0A8C3X5Q0_BCL2L11      gtgacagagaaggtggacagttgcagcctgccgag------------agg
A0A8C3X5Q0_BCL2L11      gtgacagagaaggtggacagttgcagcctgccgag------------agg
A0A8C3X5Q0_BCL2L11      gtgacagagaaggtggacagttgcagcctgccgag------------agg
A0A8C3X5Q0_BCL2L11      gtgacagagaaggtggacagttgcagcctgccgag------------agg
A0A8C3WX89_BMF-01       agaggaaggggagccggggacccagcccaggagggtctctgctgacccgt
A0A8C3X9L5_BAD-01       ctgcagataggggcctg-ggccccggccccacaggggacaggcccccagg
A0A8C3XDD1_HRK-01       cc--------------gtggccgcggc----------------cctccag
A0A8C3WID6_BBC3-01      gcccgtagagggcctagc--ccgcgacggcccgcgtcccttccccctcag
A0A8C3WID6_BBC3-02      gc-----gggcgcctggcggcggcggcggcggcggcaacaaaatcatcgg
                                                                          

A0A8C3W860_PMAIP1-      -----------------ctcagccgaatcct-------------------
A0A8C3X5Q0_BCL2L11      cctc-------------ctcagctcaggcctggggccccc---------a
A0A8C3X5Q0_BCL2L11      cctc-------------ctcagctcaggcctggggccccc---------a
A0A8C3X5Q0_BCL2L11      cctc-------------ctcagctcaggcctggggccccc---------a
A0A8C3X5Q0_BCL2L11      cctc-------------ctcagctcaggcctggggccccc---------a
A0A8C3X5Q0_BCL2L11      cctc-------------ctcagctcaggcctggggccccc---------a
A0A8C3WX89_BMF-01       ttgtccagagccag---ctggactgccccctcagccgtctgcagctcttc
A0A8C3X9L5_BAD-01       cccc-----agcaagccctggagaacggccccagacctcctgggggaagc
A0A8C3XDD1_HRK-01       ccgt---------------------------------------------g
A0A8C3WID6_BBC3-01      ccgcctggtgcc-----ctctgccgtgtcctgcggcctctgcgaacccgg
A0A8C3WID6_BBC3-02      cagc--ggtggccaggacgcggacgcg-cctgtgg--ttcgaggagcagc
                                                                          

A0A8C3W860_PMAIP1-      ----------acgcgggtggccct--------------------------
A0A8C3X5Q0_BCL2L11      cctctctccagacagagcggcaa---------------------------
A0A8C3X5Q0_BCL2L11      cctctctccagacagagcggcaaggtaatccgg-------aaggagaagg
A0A8C3X5Q0_BCL2L11      cctctctccagacagagcggcaaggtaatccgg-------aaggagaagg
A0A8C3X5Q0_BCL2L11      cctctctccagacagagcggcaaggtaatccgg-------aaggagaagg
A0A8C3X5Q0_BCL2L11      cctctctccagacagagcggca----------------------------
A0A8C3WX89_BMF-01       cctctcacgcactgctgtggccctgggcttcga-----------------
A0A8C3X9L5_BAD-01       tg-gtcaccagcaggggcagccg--------gc-----------------
A0A8C3XDD1_HRK-01       tgcgcctgcagcgcgggccgcctgggtctgcgc-----------------
A0A8C3WID6_BBC3-01      tctgcctgccgcccccgccgcccctacc-ctgctgcc----cgccgccta
A0A8C3WID6_BBC3-02      cgcggcaacaacagcaacagcagcagtcactgcagttagagcagcagcag
                                           **                             

A0A8C3W860_PMAIP1-      --------cccgccaga---------------------------------
A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      ggaccgctgcccccaaggcagcccccagg-----gcccgctggccccacc
A0A8C3X5Q0_BCL2L11      ggaccgctgcccccaaggcagcccccagg-----gcccgctggccccacc
A0A8C3X5Q0_BCL2L11      ggaccgctgcccccaaggcagcccccagg-----gcccgctggccccacc
A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3WX89_BMF-01       --------cccaccagccagga------------agacaaggccacc-ca
A0A8C3X9L5_BAD-01       cagcagcagccaccatggaggcgctggggcagagacccggagtcgccaca
A0A8C3XDD1_HRK-01       --------tcctccgccgcgca------------gctcacggccgcc-cg
A0A8C3WID6_BBC3-01      cctctgc-gcccctaccgcccc------------acccgccgtcaccgct
A0A8C3WID6_BBC3-02      cagcagcggccgccaccgcagc------------agcagccgccgccgca
                                                                          

A0A8C3W860_PMAIP1-      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      ggccagccctggcccctttgccaccagatccccgcttttcatcttcgtga
A0A8C3X5Q0_BCL2L11      ggccagccctggcccctttgccaccagatccccgcttttcatcttcgtga
A0A8C3X5Q0_BCL2L11      ggccagccctggcccctttgccaccagatccccgcttttcatcttcgtga
A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3WX89_BMF-01       gactctcagtccagcct---------------------------------
A0A8C3X9L5_BAD-01       g--------------ct---------------------------------
A0A8C3XDD1_HRK-01       g--------------ct---------------------------------
A0A8C3WID6_BBC3-01      g--------------c----------------------------------
A0A8C3WID6_BBC3-02      g--------------cg---------------------------------
                                                                          

A0A8C3W860_PMAIP1-      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      gaagatcttccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8C3X5Q0_BCL2L11      gaagatcttccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8C3X5Q0_BCL2L11      gaagatcttccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3WX89_BMF-01       -------------------ccccgagccagggtgtcatgctgccttgtgg
A0A8C3X9L5_BAD-01       -------------------ccta---cccagaggg--------gacggag
A0A8C3XDD1_HRK-01       -------------------caaggcgctcggcg------acgagctg---
A0A8C3WID6_BBC3-01      --------------------------cctggggggc---ccccgctg---
A0A8C3WID6_BBC3-02      -------------------agcggcgctcagcgggcgcgccctcctgaag
                                                                          

A0A8C3W860_PMAIP1-      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcgacacaaacccc
A0A8C3X5Q0_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcgacacaaacccc
A0A8C3X5Q0_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcgacacaaacccc
A0A8C3X5Q0_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcgacacaaacccc
A0A8C3WX89_BMF-01       ggtgactgaggaaccccagc------------------------------
A0A8C3X9L5_BAD-01       gatgacgaagggaccg-------------------aggatgagga-----
A0A8C3XDD1_HRK-01       -----caccagcgcaccat----------------gtggcggcgc-----
A0A8C3WID6_BBC3-01      ---gccagggggtccccgcagccggccccg-----aggcccgcgacccga
A0A8C3WID6_BBC3-02      gaagccgcccgccccccatcaccgtcccctccggcgtgttcatgcccccg
                                                                          

A0A8C3W860_PMAIP1-      -----------------------------------tcctgaagtcgagtg
A0A8C3X5Q0_BCL2L11      -------------------------------------------------g
A0A8C3X5Q0_BCL2L11      aagtcctccttgccaagccttc------aaccattatctcagtgcgatgg
A0A8C3X5Q0_BCL2L11      aagtcctccttgccaagccttc------aaccattatctcagtgcgatgg
A0A8C3X5Q0_BCL2L11      aagtcctccttgccaagccttc------aaccattatctcagtgcgatgg
A0A8C3X5Q0_BCL2L11      aagtcctccttgccaagccttc------aaccattatctcagtgcgatgg
A0A8C3WX89_BMF-01       ----------------------------gactcttttatggcaatgctgg
A0A8C3X9L5_BAD-01       -------------------------gctcagccccttccggggccgatca
A0A8C3XDD1_HRK-01       --------------------cgcgcgcggag-----ccggagggcgccgg
A0A8C3WID6_BBC3-01      cggtcctcagccctcactctcgcccgcggagcagcacctggaatcgccgg
A0A8C3WID6_BBC3-02      gggtcctcagccctcactctcgcccgcggagcagcacctggaatcgccgg
                                                                          

A0A8C3W860_PMAIP1-      tgtca---------------------------------------------
A0A8C3X5Q0_BCL2L11      cttccatgaggcagtctca----------ggctgaacccgcagatatgcg
A0A8C3X5Q0_BCL2L11      cttccatgaggcagtctca----------ggctgaacccgcagatatgcg
A0A8C3X5Q0_BCL2L11      cttccatgaggcagtctca----------ggctgaacccgcagatatgcg
A0A8C3X5Q0_BCL2L11      cttccatgaggcagtctca----------ggctgaacccgcagatatgcg
A0A8C3X5Q0_BCL2L11      cttccatgaggcagtctca----------ggctgaacccgcagatatgcg
A0A8C3WX89_BMF-01       ctacc----ggctccct----ctccctgccggtttccccacaggcttgcc
A0A8C3X9L5_BAD-01       agctc----ggcgccccccatcctct---gggctgcacagcgtta-cggc
A0A8C3XDD1_HRK-01       ctccc----ggcgcgct------------------ccccacctac-tggc
A0A8C3WID6_BBC3-01      tgccc----agcgctccgggggccctggcgggcggccccacccaagcggc
A0A8C3WID6_BBC3-02      tgccc----agcgctccgggggccctggcgggcggccccacccaagcggc
                                                                          

A0A8C3W860_PMAIP1-      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      cccggaga---------------------------------------tat
A0A8C3X5Q0_BCL2L11      cccggaga---------------------------------------tat
A0A8C3X5Q0_BCL2L11      cccggaga---------------------------------------tat
A0A8C3X5Q0_BCL2L11      cccggaga---------------------------------------tat
A0A8C3X5Q0_BCL2L11      cccggaga---------------------------------------tat
A0A8C3WX89_BMF-01       ccttggcgaacagccccccgaggggcagtggcagcatcgagcagaagtac
A0A8C3X9L5_BAD-01       cgcgagct---------cc-----ggaggatgagtgacgagttccag---
A0A8C3XDD1_HRK-01       cctggctg---------tgcgcg---------------------------
A0A8C3WID6_BBC3-01      cccgggag---------tccggggggaggaggagcagtgggcccgag---
A0A8C3WID6_BBC3-02      cccgggag---------tccggggggaggaggagcagtgggcccgag---
                                                                          

A0A8C3W860_PMAIP1-      ---------ttcagttcagaaggattggagacaaactgaatttccg----
A0A8C3X5Q0_BCL2L11      ggattgcgcaggagttacggcgtattggagacgaatttaatgcata---t
A0A8C3X5Q0_BCL2L11      ggattgcgcaggagttacggcgtattggagacgaatttaatgcata---t
A0A8C3X5Q0_BCL2L11      ggattgcgcaggagttacggcgtattggagacgaatttaatgcata---t
A0A8C3X5Q0_BCL2L11      ggattgcgcaggagttacggcgtattggagacgaatttaatgcata---t
A0A8C3X5Q0_BCL2L11      ggattgcgcaggagttacggcgtattggagacgaatttaatgcata---t
A0A8C3WX89_BMF-01       agatcgcccgaaaacttcagtgcattgcagaccagttccatcggct----
A0A8C3X9L5_BAD-01       ggttc-----------------------------cttcaagggacttcct
A0A8C3XDD1_HRK-01       -------------------------------------------gcc----
A0A8C3WID6_BBC3-01      agatcggggcccagctgcggcggatggctgacgacctcaacgcgct----
A0A8C3WID6_BBC3-02      agatcggggcccagctgcggcggatggctgacgacctcaacgcgct----
                                                                          

A0A8C3W860_PMAIP1-      -gcagaaa---------------------------------cttctgaat
A0A8C3X5Q0_BCL2L11      tacccaagaagg------ctggcagaatg---------------cctggc
A0A8C3X5Q0_BCL2L11      tacccaagaaggg------------gtta---------------ctgtgt
A0A8C3X5Q0_BCL2L11      tacccaagaaggtt------------------------------------
A0A8C3X5Q0_BCL2L11      tacccaagaagggtctttctgaataatta---------------ccaagc
A0A8C3X5Q0_BCL2L11      tacccaagaagggtctttctgaataatta---------------ccaagc
A0A8C3WX89_BMF-01       -tcatatgcagcagcacca-acagaaccagaatcg---------cgtgtg
A0A8C3X9L5_BAD-01       cgcccgaagagcgcgggcacagcgacgcagatgcggcaaagccccag---
A0A8C3XDD1_HRK-01       -gcgcaggtggcggcg----------------------------------
A0A8C3WID6_BBC3-01      -gtacgagcggcggagaca-agaggagcagcagcgacaccgcccctcgcc
A0A8C3WID6_BBC3-02      -gtacgagcggcggagaca-agaggagcagcagcgacaccgcccctcgcc
                                                                          

A0A8C3W860_PMAIP1-      ctgatag--------------------------ccaaattccgcctagaa
A0A8C3X5Q0_BCL2L11      attctgcacc----------------------------------------
A0A8C3X5Q0_BCL2L11      gtgcgagaacc----------------------------------cagct
A0A8C3X5Q0_BCL2L11      --------------------------------------------------
A0A8C3X5Q0_BCL2L11      agccgaagcccacccgcaaatggttatcttacgactgttgcgctacatcg
A0A8C3X5Q0_BCL2L11      agccgaagcccacccgcaaatggttatcttacgactgttgcgctacatcg
A0A8C3WX89_BMF-01       gtggcaagtcct------cctgtttctacacaacctcgccttgcatggag
A0A8C3X9L5_BAD-01       ctggaagcgctt------------------cctccagtcctggt---ggg
A0A8C3XDD1_HRK-01       ctggcgg--------------------------cctggct----------
A0A8C3WID6_BBC3-01      ctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggg
A0A8C3WID6_BBC3-02      ctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggg
                                                                          

A0A8C3W860_PMAIP1-      act--------------------------------------tga
A0A8C3X5Q0_BCL2L11      -----------------------------------------tga
A0A8C3X5Q0_BCL2L11      tcttgctggaccaggagagac--------------------tga
A0A8C3X5Q0_BCL2L11      ----------------agagcag------------------tag
A0A8C3X5Q0_BCL2L11      tccgtctggtgtggaggatgcag------------------tga
A0A8C3X5Q0_BCL2L11      tccgtctggtgtggaggatgcag------------------tga
A0A8C3WX89_BMF-01       atg--agaac---aggaatgggg-------caggtcccaggtga
A0A8C3X9L5_BAD-01       acc--ggaacttggggagaggaggctccgccccgtcccaatga-
A0A8C3XDD1_HRK-01       --------gctcggcaggcggaa------------cttg--tag
A0A8C3WID6_BBC3-01      accgtggagccccggagatggag------------cctaattag
A0A8C3WID6_BBC3-02      accgtggagccccggagatggag------------cctaattag
                                                                    

© 1998-2022Legal notice