Dataset for CDS classical BH3-containing proteins of organism Castor canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      atgaaattgagtgtgggggctgcccgggcatgttcgtgccaggtgcccag
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------

A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      ggttgcctcctgtgggtgggcccacgccctatttgtgtggagcctggcta
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------

A0A250YBU3_BBC3-02      --------------------------------------------------
A0A250YBU3_BBC3-01      ggtgtgcacagtctggagtatgtcctgccagtgggccagttagcaggaac
A0A250YBV9_BCL2L11      --------------------------------------------------
A0A250YBV9_BCL2L11      --------------------------------------------------

A0A250YBU3_BBC3-02      ------------------------atggcccgcgcacgccaggagggcag
A0A250YBU3_BBC3-01      ctgtcacaggccccagggagcgccatggcccgcgcacgccaggagggcag
A0A250YBV9_BCL2L11      ------------------------atggc--------------aaagcaa
A0A250YBV9_BCL2L11      ------------------------atggc--------------aaagcaa
                                                *****              *  *** 

A0A250YBU3_BBC3-02      ctctccggagcccgtagagggcttagctcgcgacggcccgcgccc-cttc
A0A250YBU3_BBC3-01      ctctccggagcccgtagagggcttagctcgcgacggcccgcgccc-cttc
A0A250YBV9_BCL2L11      ccttccgatgcaagttctgagtgtgac-agagaaggtggacaattgcagc
A0A250YBV9_BCL2L11      ccttccgatgcaagttctgagtgtgac-agagaaggtggacaattgcagc
                        *  ****  **  **   * *  *  *  * ** **    *     *  *

A0A250YBU3_BBC3-02      ccgctcggtcgcctggtgccctcggccgtgtcctgcggcctctgcgagcc
A0A250YBU3_BBC3-01      ccgctcggtcgcctggtgccctcggccgtgtcctgcggcctctgcgagcc
A0A250YBV9_BCL2L11      ctgctgagaggcct-----ccccagctcaggcctggggctcct-------
A0A250YBV9_BCL2L11      ctgctgagaggcct-----ccccagctcaggcctggggctcct-------
                        * ***  *  ****     ** * **   * **** ***  **       

A0A250YBU3_BBC3-02      gggcctgcccgccgccccagccgcc-------------------------
A0A250YBU3_BBC3-01      gggcctgcccgccgccccagccgcc-------------------------
A0A250YBV9_BCL2L11      --acctccctacagacagagccgccaggtaatcctgaaggcagtcccgca
A0A250YBV9_BCL2L11      --acctccctacagacagagccgc--------------------------
                           *** **  * * *  ******                          

A0A250YBU3_BBC3-02      ------------------------------------------ccggccct
A0A250YBU3_BBC3-01      ------------------------------------------ccggccct
A0A250YBV9_BCL2L11      ggcgaaggggatcgctgtccccacggcagccctcagggcccgctggcccc
A0A250YBV9_BCL2L11      --------------------------------------------------

A0A250YBU3_BBC3-02      gctgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccg
A0A250YBU3_BBC3-01      gctgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccg
A0A250YBV9_BCL2L11      accggccagccctggcccttttgctaccagatccccgcttttcatctttg
A0A250YBV9_BCL2L11      --------------------------------------------------

A0A250YBU3_BBC3-02      cagccttggggggcccccgctggcctggaggtccccg-------------
A0A250YBU3_BBC3-01      cagccttggggggcccccgctggcctggaggtccccg-------------
A0A250YBV9_BCL2L11      -----tgagaagatcttccctgctgtctcgatcctccagtgggtatttct
A0A250YBV9_BCL2L11      --------------------------------------------------

A0A250YBU3_BBC3-02      ---------cagccggccccgaggcccgcgtccggatggtcctcagccat
A0A250YBU3_BBC3-01      ---------cagccggccccgaggcccgcgtccggatggtcctcagccat
A0A250YBV9_BCL2L11      cttttgacacagacag----gagcccggcaccca--------tgagttgt
A0A250YBV9_BCL2L11      ---------cagacag----gagcccggcaccca--------tgagttgt
                                 *** * *    *** ** **  **         * **   *

A0A250YBU3_BBC3-02      cactatcaccagcccagcagcacctagagtcacccgtgcccagcgtc---
A0A250YBU3_BBC3-01      cactatcaccagcccagcagcacctagagtcacccgtgcccagcgtc---
A0A250YBV9_BCL2L11      gacaa--atcaacacaa----accccaagtcctccttgccaggccttcaa
A0A250YBV9_BCL2L11      gacaa--atcaacacaa----accccaagtcctccttgccaggccttcaa
                         ** *  * ** * **     ***   ****  ** ****  ** *    

A0A250YBU3_BBC3-02      ccggaggccctggcgggcggccccacccaggcggcccc---cggagtccg
A0A250YBU3_BBC3-01      ccggaggccctggcgggcggccccacccaggcggcccc---cggagtccg
A0A250YBV9_BCL2L11      ccattatctcagtgcaatggcttccatgaggcagtctcaggtggaaccca
A0A250YBV9_BCL2L11      ccattatctcagtgcaatggcttccatgaggcagtctcaggtggaaccca
                        **     * * *      ***  *    **** * * *    ***  ** 

A0A250YBU3_BBC3-02      gggggaggaggagcagtgggcccgggagatcggggccc-----agctgcg
A0A250YBU3_BBC3-01      gggggaggaggagcagtgggcccgggagatcggggccc-----agctgcg
A0A250YBV9_BCL2L11      tggaca----------tgcgcccagagatttggatcgcacaagagttgcg
A0A250YBV9_BCL2L11      tggaca----------tgcgcccagagatttggatcgcacaagagttgcg
                         **  *          ** **** *    * **  * *     ** ****

A0A250YBU3_BBC3-02      gcggatggcggacgacctcaacgcgcagtacgagcggcggaga-------
A0A250YBU3_BBC3-01      gcggatggcggacgacctcaacgcgcagtacgagcggcggaga-------
A0A250YBV9_BCL2L11      acgtatcggagacgaattcaatgcatattacccaaggagggtatttttga
A0A250YBV9_BCL2L11      acgtatcggagacgaattcaatgcatattacccaaggagggtatttttga
                         ** ** *  *****  **** **  * ***    ** **  *       

A0A250YBU3_BBC3-02      --------caagaagagcaacagcaacaccgcccctcgccctggagggtg
A0A250YBU3_BBC3-01      --------caagaagagcaacagcaacaccgcccctcgccctggagggtg
A0A250YBV9_BCL2L11      ataattaccaaggag------tggaagaccacccc---------------
A0A250YBV9_BCL2L11      ataattaccaaggag------tggaagaccacccc---------------
                                **** **       * ** *** ****               

A0A250YBU3_BBC3-02      ctgtacaatgtcatcatgggactcctgcccttacccaggggcccgggagc
A0A250YBU3_BBC3-01      ctgtacaatgtcatcatgggactcctgcccttacccaggggcccgggagc
A0A250YBV9_BCL2L11      ---caaatggttatcttacgactgttacgttacatcatccgtctggtg--
A0A250YBV9_BCL2L11      ---caaatggttatcttacgactgttacgttacatcatccgtctggtg--
                            * *  ** *** *  ****  * *  *    **   * * **    

A0A250YBU3_BBC3-02      cccggagatggagcccaattag
A0A250YBU3_BBC3-01      cccggagatggagcccaattag
A0A250YBV9_BCL2L11      --tggagaatg-----cattga
A0A250YBV9_BCL2L11      --tggagaatg-----cattga
                           *****  *      ***  

© 1998-2020Legal notice