Dataset for CDS BAD of organism Capra hircus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452ER54_BAD-01      atggggaccccggagaatccctcagcggctcccacaactcggaagctgag
A0A452ER54_BAD-02      --------------------------------------------------
                                                                         

A0A452ER54_BAD-01      catccggagacgtagaagagaatcaggaggaaggcagtgggcggggcccc
A0A452ER54_BAD-02      ----------------------------------tatcgggcttgggccc
                                                          *  ****  ** ***

A0A452ER54_BAD-01      ggggaagcatgttccagatcccagagtttgagcagagtgagcaggaagac
A0A452ER54_BAD-02      ag---agcatgttccagatcccagagtttgagcagagtgagcaggaagac
                        *   *********************************************

A0A452ER54_BAD-01      tccagccctgcagataggggcctgggccccagccccacaggggacaggcc
A0A452ER54_BAD-02      tccagccctgcagataggggcctgggccccagccccacaggggacaggcc
                       **************************************************

A0A452ER54_BAD-01      cccaggtctca------------------ccccgggcctcctgggggaag
A0A452ER54_BAD-02      cccaggtctcagcaagcactggctaacagccccgggcctcctgggggaag
                       ***********                  *********************

A0A452ER54_BAD-01      ctggtcaccagcaggggcagccggccggcagcagccaccatggaggcact
A0A452ER54_BAD-02      ctggtcaccagcaggggcagccggccggcagcagccaccatggaggcact
                       **************************************************

A0A452ER54_BAD-01      ggggctgtggagacccggagtcgtcacagctcctaccccgcggggccaga
A0A452ER54_BAD-02      ggggctgtggagacccggagtcgtcacagctcctaccccgcggggccaga
                       **************************************************

A0A452ER54_BAD-01      ggatgatgaagggacggaggaggaggatctcggcccctttaggggccgct
A0A452ER54_BAD-02      ggatgatgaagggacggaggaggaggatctcggcccctttaggggccgct
                       **************************************************

A0A452ER54_BAD-01      cgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcgag
A0A452ER54_BAD-02      cgcgttcggcgccccccaacctctgggctgcacagcgatatggccgcgag
                       **************************************************

A0A452ER54_BAD-01      ctccgaaggatgagcgacgagtttcacgtctccttcaaggggcttcctcg
A0A452ER54_BAD-02      ctccgaaggatgagcgacgagtttcacgtctccttcaaggggcttcctcg
                       **************************************************

A0A452ER54_BAD-01      cccgaagagcgcgggaacggcaacgcaaatgcgacaaagccctagctgga
A0A452ER54_BAD-02      cccgaagagcgcgggaacggcaacgcaaatgcgacaaagccctagctgga
                       **************************************************

A0A452ER54_BAD-01      cgcgcttcctccagtcctggttgagccggaacttggggaggggaggctcc
A0A452ER54_BAD-02      cgcgcttcctccagtcctggttgagccggaacttggggaggggaggctcc
                       **************************************************

A0A452ER54_BAD-01      gccccctcccagtga
A0A452ER54_BAD-02      gccccctcccagtga
                       ***************

© 1998-2020Legal notice