Dataset for CDS BCL2L11 of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      atgcccgc-------------------------------------gcgtg
A0A2R8M6L7_BCL2L11      atgttcccggcggctgcgacccgggccgcgagggccagaggggcagcgcg
                                                                          

A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      tgtgtgcaccagtttc----------------acaagctgtt-----gac
A0A2R8M6L7_BCL2L11      cggagccgtcggctgcccggcggagcgcagcggcgggctggccggaaggc
                                                                          

A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      attgttactgtcttttgtttggggttacgaagtttagtccc---------
A0A2R8M6L7_BCL2L11      gtgggctctgtgctgcgccggggactctgaacccgagtcccgggctttgt
                                                                          

A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ctcctgcattgtcttcgtggtgacggtcaggggccgccgggtcggcgaaa
                                                                          

A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ----------------------accctctaccaaacaaaaattatgtctt
A0A2R8M6L7_BCL2L11      ggcgcgggtcggacgccgtggtgccccgtcccgggccagaacgctgcgct
                                                                          

A0A2R8M6L7_BCL2L11      --------------------------------atggcaaagcaaccttcc
A0A2R8M6L7_BCL2L11      t--------attattttagaaaaagagaccaaatggcaaagcaaccttcc
A0A2R8M6L7_BCL2L11      ctgaagggaaggctcggacaaaaagagaccaaatggcaaagcaaccttcc
                                                        ******************

A0A2R8M6L7_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2R8M6L7_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
A0A2R8M6L7_BCL2L11      gatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcgga
                        **************************************************

A0A2R8M6L7_BCL2L11      gagacctccccagctcagacctggggcccctacctccctacagacagagc
A0A2R8M6L7_BCL2L11      gagacctccccagctcagacctggggcccctacctccctacagacagagc
A0A2R8M6L7_BCL2L11      gagacctccccagctcagacctggggcccctacctccctacagacagagc
                        **************************************************

A0A2R8M6L7_BCL2L11      cacaaggtaatcccgaaggcaatcacggaggtgaaggggacagctgcctc
A0A2R8M6L7_BCL2L11      caca----------------------------------------------
A0A2R8M6L7_BCL2L11      caca----------------------------------------------
                        ****                                              

A0A2R8M6L7_BCL2L11      cacggcagccctcagggcccgctggccccaccggccagccccggcccttt
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
                                                                          

A0A2R8M6L7_BCL2L11      tgctaccagatccccgcttttcatctttgtgagaagatcctccgtgctgt
A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      --------------------------------------------------
                                                                          

A0A2R8M6L7_BCL2L11      ctcgatcctccagtgggtatttctcttttgacacagacaggagcccagca
A0A2R8M6L7_BCL2L11      ----------------------------------agacaggagcccagca
A0A2R8M6L7_BCL2L11      ----------------------------------agacaggagcccagca
                                                          ****************

A0A2R8M6L7_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
A0A2R8M6L7_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
A0A2R8M6L7_BCL2L11      cccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggc
                        **************************************************

A0A2R8M6L7_BCL2L11      cttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctg
A0A2R8M6L7_BCL2L11      cttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctg
A0A2R8M6L7_BCL2L11      cttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctg
                        **************************************************

A0A2R8M6L7_BCL2L11      aacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgt
A0A2R8M6L7_BCL2L11      aacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgt
A0A2R8M6L7_BCL2L11      aacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgt
                        **************************************************

A0A2R8M6L7_BCL2L11      atcggagacgagtttaacgcttattatccaaggaggtta-----------
A0A2R8M6L7_BCL2L11      atcggagacgagtttaacgcttattatccaaggagggtatttttgaataa
A0A2R8M6L7_BCL2L11      atcggagacgagtttaacgcttattatccaaggagggtatttttgaataa
                        ************************************ **           

A0A2R8M6L7_BCL2L11      --------------------------------------------------
A0A2R8M6L7_BCL2L11      ttaccaagcagctgaagaccacccacacatggttatcttacgactgttac
A0A2R8M6L7_BCL2L11      ttaccaagcagctgaagaccacccacacatggttatcttacgactgttac
                                                                          

A0A2R8M6L7_BCL2L11      ----------------------gagaa---atag-
A0A2R8M6L7_BCL2L11      gttacattgtccgcctggtgtggagaatgcattga
A0A2R8M6L7_BCL2L11      gttacattgtccgcctggtgtggagaatgcattga
                                              *****   ** * 

© 1998-2020Legal notice