Dataset for CDS classical BH3-containing proteins of organism Cairina moschata domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3GPS7_BMF-01       atggatcgccccagctacct-----ggaagaggactattctagcctggat
A0A8C3BLB7_PMAIP1-      at-g--ccgtgcaggaccct------------------------------
A0A8C3BDR3_BCL2L11      atgg--ccaagcagccccccgaggcgaaggcgcagcgcggccgccaggct
A0A8C3BDR3_BCL2L11      atgg--ccaagcagccccccgaggcgaaggcgcagcgcggccgccaggct
                        ** *  *    ***   **                               

A0A8C3GPS7_BMF-01       gggctggacgatgacgtgtttcactctgatgactttggacttgcaggtca
A0A8C3BLB7_PMAIP1-      ---------------------------------------------gcgca
A0A8C3BDR3_BCL2L11      gggcgg---------ctgcccccggccgaggggccgggcccggcggcgca
A0A8C3BDR3_BCL2L11      gggcgg---------ctgcccccggccgaggggccgggcccggcggcgca
                                                                     *  **

A0A8C3GPS7_BMF-01       gcctgg------------------------tgagatgactgcaacaggca
A0A8C3BLB7_PMAIP1-      aat-----------------------------------------------
A0A8C3BDR3_BCL2L11      gctgaggcccggagcccccgccgccctgcccggcctccccgcggccgcct
A0A8C3BDR3_BCL2L11      gctgaggcccggagcccccgccgccctgcccggcctccccgcggccgcct
                                                                          

A0A8C3GPS7_BMF-01       ttttc---------------------------------------------
A0A8C3BLB7_PMAIP1-      --------------------------------------------------
A0A8C3BDR3_BCL2L11      ccttctcctcctcgtcctcctcctcctcctcctcgccgtcgtcgtcggcc
A0A8C3BDR3_BCL2L11      ccttctcctcctcgtcctcctcctcctcctcctcgccgtcgtcgtcggcc
                                                                          

A0A8C3GPS7_BMF-01       -acacagaaccag--tcctacagctgccttctgggga-------------
A0A8C3BLB7_PMAIP1-      -ctgcacaacccg-----cccggcaggcggtggcgga-------------
A0A8C3BDR3_BCL2L11      gccgcccggcccgtctctcccggcagcccgccgcgggcgcagccgccgcc
A0A8C3BDR3_BCL2L11      gccgcccggcccgtctctcccggcagcccgccgcgggcgcagccgccgcc
                            *    ** *       * ** * *    * **              

A0A8C3GPS7_BMF-01       --------------------------ggtttcaactatttcccctcacac
A0A8C3BLB7_PMAIP1-      ----------------------------------------------gtgc
A0A8C3BDR3_BCL2L11      cgccagccccggcccgttcgccacccgctcgccgctcttcatcttcgtgc
A0A8C3BDR3_BCL2L11      cgccagccccggcccgttcgccacccgctcgccgctcttcatcttcgtgc
                                                                         *

A0A8C3GPS7_BMF-01       a-------ctgctgtggtcccg--------------------------gt
A0A8C3BLB7_PMAIP1-      g--------cgctggagctgcg----------------------------
A0A8C3BDR3_BCL2L11      ggaggtcgccgctgctgtcgcgctcctccagcggctacttctccttcgag
A0A8C3BDR3_BCL2L11      ggaggtcgccgctgctgtcgcgctcctccagcggctacttctccttcgag
                                  ****  *   **                            

A0A8C3GPS7_BMF-01       gtcaggcat-----------cctgagcagcaggacaaggcaactcaaaca
A0A8C3BLB7_PMAIP1-      --------------------caggatcggc--gacaagg-----------
A0A8C3BDR3_BCL2L11      gccgagcgcagccccgcgcccatgagctgc--gacaaggccacgcagacc
A0A8C3BDR3_BCL2L11      gccgagcgcagccccgcgcccatgagctgc--gacaaggccacgcagacc
                                            *  ** * **  *******           

A0A8C3GPS7_BMF-01       ctcagcccgtcctcttccagtcaggatgtta--tgttgccttgtggagtc
A0A8C3BLB7_PMAIP1-      ------cggacct------g------cgacagcggat-cct---------
A0A8C3BDR3_BCL2L11      cccagcccgccct------gccaggccgtcagccactacct---------
A0A8C3BDR3_BCL2L11      cccagcccgccct------gccaggccgtcagccactacct---------
                              * * ***      *       *  *     * ***         

A0A8C3GPS7_BMF-01       actgaagagccccggagactcttctatgggaatgctggttaccgtttaca
A0A8C3BLB7_PMAIP1-      ------gaacctca---------------------tcgc-----------
A0A8C3BDR3_BCL2L11      ------gagcgcca---------------------tggcttccaggtggc
A0A8C3BDR3_BCL2L11      ------gagcgcca---------------------tggcttccaggtggc
                              ** *  *                      * *            

A0A8C3GPS7_BMF-01       tgttcctccagttggctttgcattggatccacacctccaagaggagcctc
A0A8C3BLB7_PMAIP1-      --------------------------------------------------
A0A8C3BDR3_BCL2L11      ggtctcactcgctagc----------------------------------
A0A8C3BDR3_BCL2L11      ggtctcactcgctagc----------------------------------
                                                                          

A0A8C3GPS7_BMF-01       aggaaggtcagcaggaggcgcgtgctgaggtgcagattgcacggaagttg
A0A8C3BLB7_PMAIP1-      -------------------------------------------aaagctg
A0A8C3BDR3_BCL2L11      ----------agaagaaatacagccagaaatatggattgcacaggagctg
A0A8C3BDR3_BCL2L11      ----------agaagaaatacagccagaaatatggattgcacaggagctg
                                                                     ** **

A0A8C3GPS7_BMF-01       cagtgcattgcaga-----ccagttccaccggctccacatacagag----
A0A8C3BLB7_PMAIP1-      ------------------------------ttctgccccaaaa-------
A0A8C3BDR3_BCL2L11      cggcgcattggagatgaattcaatgcctcctattgtccaagaaggg----
A0A8C3BDR3_BCL2L11      cggcgcattggagatgaattcaatgcctcctattgtccaagaagggtaat
                                                         *   *    *       

A0A8C3GPS7_BMF-01       --------------------------------------------------
A0A8C3BLB7_PMAIP1-      --------------------------------------------------
A0A8C3BDR3_BCL2L11      ----------------------------------gtttct----------
A0A8C3BDR3_BCL2L11      tttcttatttttactttccatttctttacacttagtctctaaaagggaaa
                                                                          

A0A8C3GPS7_BMF-01       -gcatcagcagaacagaaatcaagtgtggtggcagcttttt---------
A0A8C3BLB7_PMAIP1-      --------------------------------------------------
A0A8C3BDR3_BCL2L11      --------------tgga---taaccacgtgggaaacccccagatcatt-
A0A8C3BDR3_BCL2L11      agcttaatcatatctggaaactagctctgcggcaagtgtttcgttcactc
                                                                          

A0A8C3GPS7_BMF-01       --------------------------------------------------
A0A8C3BLB7_PMAIP1-      --------------------------------------------------
A0A8C3BDR3_BCL2L11      ------------------------------attc---------------t
A0A8C3BDR3_BCL2L11      aaatgtagaaaaggatgcgcgggtggttgcattcacccgggtgcaggggc
                                                                          

A0A8C3GPS7_BMF-01       -ctctttctacacaacttggccttaaacg---------------------
A0A8C3BLB7_PMAIP1-      --------------------------------------------------
A0A8C3BDR3_BCL2L11      gcgcctcctgcattat---atcatccgcc---------tcat--------
A0A8C3BDR3_BCL2L11      gtgctgcctgcgctgcggagttgtccgctgttgcagtgtcattaaacgca
                                                                          

A0A8C3GPS7_BMF-01       -------------------------tggaggcgaacaggaaccac-----
A0A8C3BLB7_PMAIP1-      --------------------------------------------------
A0A8C3BDR3_BCL2L11      ------------------------ctggag--------------------
A0A8C3BDR3_BCL2L11      ctcagagtcaccagcgagttgggactggagactttcagttattgcagctt
                                                                          

A0A8C3GPS7_BMF-01       ----------actgggcagaggtga-----------------------
A0A8C3BLB7_PMAIP1-      --------------------cgtga-----------------------
A0A8C3BDR3_BCL2L11      ---------------gatgcagtga-----------------------
A0A8C3BDR3_BCL2L11      tgttcccagtaccaagagccagtaaagcatggtctgctgctgggttag
                                             ** *                       

© 1998-2022Legal notice