Dataset for CDS BCL2L11 of organism Cairina moschata domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3BDR3_BCL2L11      atggccaagcagccccccgaggcgaaggcgcagcgcggccgccaggctgg
A0A8C3BDR3_BCL2L11      atggccaagcagccccccgaggcgaaggcgcagcgcggccgccaggctgg
                        **************************************************

A0A8C3BDR3_BCL2L11      gcggctgcccccggccgaggggccgggcccggcggcgcagctgaggcccg
A0A8C3BDR3_BCL2L11      gcggctgcccccggccgaggggccgggcccggcggcgcagctgaggcccg
                        **************************************************

A0A8C3BDR3_BCL2L11      gagcccccgccgccctgcccggcctccccgcggccgcctccttctcctcc
A0A8C3BDR3_BCL2L11      gagcccccgccgccctgcccggcctccccgcggccgcctccttctcctcc
                        **************************************************

A0A8C3BDR3_BCL2L11      tcgtcctcctcctcctcctcctcgccgtcgtcgtcggccgccgcccggcc
A0A8C3BDR3_BCL2L11      tcgtcctcctcctcctcctcctcgccgtcgtcgtcggccgccgcccggcc
                        **************************************************

A0A8C3BDR3_BCL2L11      cgtctctcccggcagcccgccgcgggcgcagccgccgcccgccagccccg
A0A8C3BDR3_BCL2L11      cgtctctcccggcagcccgccgcgggcgcagccgccgcccgccagccccg
                        **************************************************

A0A8C3BDR3_BCL2L11      gcccgttcgccacccgctcgccgctcttcatcttcgtgcggaggtcgccg
A0A8C3BDR3_BCL2L11      gcccgttcgccacccgctcgccgctcttcatcttcgtgcggaggtcgccg
                        **************************************************

A0A8C3BDR3_BCL2L11      ctgctgtcgcgctcctccagcggctacttctccttcgaggccgagcgcag
A0A8C3BDR3_BCL2L11      ctgctgtcgcgctcctccagcggctacttctccttcgaggccgagcgcag
                        **************************************************

A0A8C3BDR3_BCL2L11      ccccgcgcccatgagctgcgacaaggccacgcagacccccagcccgccct
A0A8C3BDR3_BCL2L11      ccccgcgcccatgagctgcgacaaggccacgcagacccccagcccgccct
                        **************************************************

A0A8C3BDR3_BCL2L11      gccaggccgtcagccactacctgagcgccatggcttccaggtggcggtct
A0A8C3BDR3_BCL2L11      gccaggccgtcagccactacctgagcgccatggcttccaggtggcggtct
                        **************************************************

A0A8C3BDR3_BCL2L11      cactcgctagcagaagaaatacagccagaaatatggattgcacaggagct
A0A8C3BDR3_BCL2L11      cactcgctagcagaagaaatacagccagaaatatggattgcacaggagct
                        **************************************************

A0A8C3BDR3_BCL2L11      gcggcgcattggagatgaattcaatgcctcctattgtccaagaaggg---
A0A8C3BDR3_BCL2L11      gcggcgcattggagatgaattcaatgcctcctattgtccaagaagggtaa
                        ***********************************************   

A0A8C3BDR3_BCL2L11      -----------------------------------gtttct---------
A0A8C3BDR3_BCL2L11      ttttcttatttttactttccatttctttacacttagtctctaaaagggaa
                                                           ** ***         

A0A8C3BDR3_BCL2L11      ---------------tgga---taaccacgtgggaaacccccagatcatt
A0A8C3BDR3_BCL2L11      aagcttaatcatatctggaaactagctctgcggcaagtgtttcgttcact
                                       ****   ** *   * ** **       * *** *

A0A8C3BDR3_BCL2L11      -------------------------------attc---------------
A0A8C3BDR3_BCL2L11      caaatgtagaaaaggatgcgcgggtggttgcattcacccgggtgcagggg
                                                       ****               

A0A8C3BDR3_BCL2L11      tgcgcctcctgcattat---atcatccgcc---------tcat-------
A0A8C3BDR3_BCL2L11      cgtgctgcctgcgctgcggagttgtccgctgttgcagtgtcattaaacgc
                         * **  *****  *      *  *****          ****       

A0A8C3BDR3_BCL2L11      -------------------------ctggag-------------------
A0A8C3BDR3_BCL2L11      actcagagtcaccagcgagttgggactggagactttcagttattgcagct
                                                 ******                   

A0A8C3BDR3_BCL2L11      ----------------gatgcagtga-----------------------
A0A8C3BDR3_BCL2L11      ttgttcccagtaccaagagccagtaaagcatggtctgctgctgggttag
                                        **  **** *                       

© 1998-2022Legal notice